sgRNA guide sequences were selected for compatibility with both SpCas9 and coBE3: TRBC 1 and 2/Exon 15′ CCCACCAGCTCAGCTCCACG 3′; CD7 Exon 25′ CACCTGCCAGGCCATCACGG 3′.
BE guides were designed to mediate cytidine to uracil to thymidine (C>U>T) modification in exon 1 of TRBC1/2 with an intended amino acid conversion of Tryptophan (Trp) to stop (STOP*) (protospacer positions G > A and/or G6 > A). CD7 exon 2-targeting sgRNA promoted the deamination-mediated conversion of Glutamine (Gln) to a premature stop (STOP*) (protospacer positions C8 > T).
CleanCap® Cas9 mRNA encoded SpCas9 was supplied by Trilink US. Custom-made codon optimised BE3 (coBE3) was supplied as CleanCap (Trilink US) with a Cap 1 structure, and polyadenylated to increase expression and stability.