Pneumatic picopump

Viral injections were performed as previously described (Beier et al., 2016 (link); Ma et al., 2020 (link)). Briefly, VSV and lentivirus stock was diluted to final working concentrations (described in the "Results" section) with DMEM (11995073; Fisher Scientific), with Fast Green dye (BP123-10; Fisher Scientific) as the injection marker. Glass capillaries (TW100F-4; World Precision Instruments) were pulled into injection needles with a pipette puller (P-97; Sutter Instruments), and the tips were trimmed to create a ~10 μm opening. The injection needle was mounted into a microelectrode holder connected to a pneumatic PicoPump (World Precision Instruments). For retina injection, 3 dpf larvae were anesthetized in Tricaine (0.013% w/v, AC118000500; Fisher Scientific) and mounted laterally inside the center chamber of a glass-bottom dish (P50G-1.5-14-F; MatTek) with 1.5% low melting-point agarose (BP1360; Fisher Scientific). 0.5 nl of virus solution was injected inside the temporal retina.

Mad2 (5′-ATGGCACAGCAGCTCGCCCGAGAGC-3′) and Mad2 5-base mismatch (ATGGCGCTGCAGCTCTCCCGGGAGC) morpholinos (Gene Tools LLC, USA)34 (link), were diluted in water, and introduced into oocytes by microinjection at tip concentrations of 1 mM. Microinjections into oocytes were performed on the stage of an inverted TE300 microscope (Nikon, Japan), at room temperature, using micromanipulators (Narishige, Japan). A single injection with a 0.1–0.3% volume was achieved using timed injection on a Pneumatic Picopump (World Precision Instruments, UK)38 (link). Oocytes were incubated in MEM media with 5% CO₂ for 24 h to allow for protein knockdown.

At 24 hpf, CSN5i-3 was added to the water of Tg(fli1:GFP)^y1casper zebrafish embryos to treat them for 48–72 hours with the compound. Zebrafish embryos were subsequently injected with ~1 nl of a 2 mg/ml solution of 70 kDa TMR dextran (#D1818) (Thermo Fisher Scientific) into the vasculature at the intersection of the common cardinal vein, the posterior cardinal vein and the primary head sinus using a Pneumatic PicoPump (#SYS-PV820) (World precision instruments). During injection and imaging, the zebrafish embryos were anaesthetized in 0.02% (w/v) buffered 3-aminobenzoic acid methyl ester (pH 7.0) (Tricaine) (#A5040) (Sigma-Aldrich). For live imaging, zebrafish embryos were mounted in an uncoated 8-well μ-slide (#80827) (Ibidi) in 1.5% low melting point agarose dissolved in egg water (60 μg/mL sea salts (Sigma-Aldrich; S9883) in MilliQ) with addition of 0.02% (w/v) buffered 3-aminobenzoic acid methyl ester (pH 7.0) (Tricaine) (#A5040) (Sigma-Aldrich). Zebrafish embryos were imaged after 20 minutes using a Zeiss wide field microscope at 10x magnification.

About 5-10 pL of in-vitro transcribed mRNA at 0.1 mg/mL in RNase-free water (Ambion) was microinjected into mature oocytes in M2 medium (under oil) using a Pneumatic PicoPump (World Precision Instruments). Microinjected oocytes were cultured in M16 medium supplemented with IBMX for 1 hr to enable sufficient expression of microinjected mRNA. Oocytes were then released into IBMX-free M16 medium and maintained at 37°C and 5% CO₂.

Three wild-type and three NLGN3-R451C mutant mice were used for the following analyses. Under anesthesia by inhalation of 3.5% isoflurane, a glass pipette filled with 2–3 μl of 10% solution of dextran Alexa Fluor-594 (DA-594, Invitrogen) in PBS was inserted stereotaxically into the inferior olive by the dorsal approach, as described previously (Miyazaki and Watanabe, 2011 (link)). The tracer was injected by air pressure (Pneumatic Picopump; World Precision Instruments). After 4 days of the tracer injection, mice were deeply anesthetized with sodium pentobarbital (100 μg/g of body weight, i.p.) and fixed by transcardial perfusion at P14 or P28. To visualize tracer-labeled CFs, all CF terminals, and PC somata and dendrites, microslicer sections of the cerebellum from DA-594-injected mice were incubated overnight with a mixture of primary antibodies against calbindin (a marker for PC; rabbit serum, 1:10,000 dilution; AB_2571568) and VGluT2 (a marker for CF terminals; goat, 1 μg/ml, AB_2571620), followed by 2 h incubation with a mixture of species-specific secondary antibodies as described above. Images of the triple labeling were taken with a confocal laser-scanning microscope (FV1000, Olympus, Tokyo, Japan).

Cells were stimulated with local application of 200-400 μM of 4-HNE (Cayman Chemical, catalog # 32100), 100-200 μM of CA (Sigma-Aldrich, catalog # W228605), 2–250 μM of ATP (Sigma-Aldrich), 20–100 μM of AITC (Sigma-Aldrich, catalog # 377430) or 5-200 µM pBQN (Sigma-Aldrich, catalog # B10358) through puff pipettes. The size of the stimulated area was regulated by controlling the diameter of the pipette tip (3–6 µm) and the pressure applied to the puff pipette (2–4 kPa). The pipette tip was positioned 8–10 µm above the surface of the cells to be stimulated. Pressure pulses were generated by a pneumatic pico-pump (World Precision Instruments) that was triggered by MetaMorph or pClamp software (Molecular Devices). The output of the pico-pump was also coupled to a Traceable^TM manometer gauge (Fisher Scientific), which allowed the precise measurement and adjustment of the applied pressure. The system had a small delay (~40 ms) between the software-generated trigger and the beginning of the actual drug delivery to the cells. This delay was determined by placing a puff pipette at a distance of 8–10 µm from the patch-clamp pipette and measuring the shift of the patch-clamp pipette offset upon puff application of a K⁺-rich solution. We quantified Ca²⁺ responses only in the cells that were within a 35 µm radius around the tip of the puff pipette.

Surgeries for AAV injections were conducted under pentobarbital anesthesia (50 mg/kg, i.p.) and isoflurane (2%, inhalation) using a stereotaxic instrument (David Kopf Instruments, Tujunga, CA, USA). Recombinant AAV-hSyn-FLEX-hM3Dq-mCherry (serotype: DJ; 600 nl/injection, 3 × 10¹² copies/ml) was stereotaxically and bilaterally injected into the LHA of orexin-Cre mice. A glass micropipette pulled with a puller (Sutter Instrument Novato, CA, USA) with a tip diameter of 100 μm was filled with AAV. An air pressure injector system (Pneumatic PicoPump; World Precision Instruments, Inc., Sarasota, FL, USA) was connected to the glass micropipette with a polyethylene tube. Air pressure (10–20 psi) was applied to inject the AAV. Injection sites were as follows: from bregma −1.4 mm, lateral ± 0.7 mm, ventral −5.0 mm for AAV-hSyn-FLEX-hM3Dq-mCherry. Three weeks after the AAV injection, mice were subjected to behavioral experiments.