The largest database of trusted experimental protocols
Sourced in United States

The AM4611 is a versatile laboratory instrument designed for precise temperature control and monitoring. It features a digital display and intuitive controls for easy operation. The core function of the AM4611 is to provide accurate and reliable temperature regulation for various laboratory applications.

Automatically generated - may contain errors

75 protocols using am4611

1

Overexpression and RNAi of YAP/TEAD Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
For overexpression experiments, YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056), both gifts from Marius Sudol, pRK5-Myc-Fus-R495X,68 (link) gift from Jiou Wang, or EGFP-TAZ (made in the Cai lab) using Lipofectamine 3000 Transfection Reagent (cat. no. L3000015), for 16 h. For RNAi experiments, a mixture of Lats1 siRNA (Thermo Fisher, Silencer Select s17393) and Lats2 siRNA (Thermo Fisher, Silencer Select s25503) was used at a final concentration of 10 nM, or the scrambled negative control siRNA was used at a final concentration of 20 nM (Thermo Fisher, AM4611), and were transfected into cells using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher, cat. no. 13778075) for 48 h. For siTEAD1 experiments, the TEAD1 siRNA (Thermo Fisher, Silencer Select s13962) or scrambled negative control siRNA was used at a final concentration of 10 nM (Thermo Fisher, AM4611), and were transfected into cells using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher, cat. no. 13778075) for 48 h, after which cells were replated for live cell imaging and RT-qPCR.
+ Open protocol
+ Expand
2

DAXX Knockdown via siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection and small interfering RNA (siRNA)-mediated knockdown of DAXX expression was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific, Massachusetts, USA) according to the manufacturer’s instructions. Briefly, 5 pmol of pre-validated, quality controlled and DAXX-specific siRNA (DAXXHSS102654 Sequence (5’ – 3’) (RNA) – GGA GUU GGA UCU CUC AGA AUU GGA U), Stealth, Thermo Fisher Scientific, Massachusetts, USA) was used for transfection. An equal concentration of scrambled RNA (scrRNA) (AM4611, Thermo Fisher Scientific, Massachusetts, USA) was used as a control.
+ Open protocol
+ Expand
3

Human Primary Myotube Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
The siRNA for FRZB (s5369) knockdown was purchased from Thermo Fisher Scientific. A scrambled siRNA was used as a negative control (AM4611, Thermo Fisher Scientific). Cells plated at 24,000 cells/cm2 were transfected with the siRNA at a concentration of 5 nM using RiboCellin transfection reagent (Eurobio, Les Ulis, France) following the manufacturer’s instructions. After 8 days of differentiation, human primary myotubes were incubated with the corresponding siRNA and the transfection agent. Finally, the RNA obtained from these cultures was analyzed 48 h post-transfection by quantitative real-time PCR. Likewise, proteins from these cultures were analyzed 72 h post-transfection.
+ Open protocol
+ Expand
4

Measuring Ca2+ Signaling in EGFP-IP3R1 HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
EGFP-IP3R1 HeLa cells were plated in clear-bottomed 96-well plates (Greiner Bio-One) coated with fibronectin (10 µg ml−1). Cells were transfected with siRNA directed against GFP (50 nM, #AM4626, ThermoFisher) or a nonsilencing control siRNA (50 nM, #AM4611, ThermoFisher) using siPORT NeoFX transfection reagent (ThermoFisher, 220 ng siRNA per µl reagent). After 72 h, cells were washed with HEPES-buffered saline (HBS: 135 mM NaCl, 5.9 mM KCl, 1.2 mM MgCl2, 1.5 mM CaCl2, 11.6 mM HEPES, 11.5 mM glucose; pH 7.3), loaded with Fluo-8 by incubation in HBS with Fluo-8 AM (2 µM, 60 min, 20 °C), washed and incubated in HBS (60 min, 20 °C) before experiments. A FlexStation 3 microplate reader (Molecular Devices) was used to measure Fluo-8 fluorescence at 20 °C. After addition of BAPTA in Ca2+-free HBS (final BAPTA and CaCl2 concentrations = 2.5 and 0.75 mM, respectively; free [Ca2+]<40 nM), histamine (100 µM) was added to stimulate IP3 formation through endogenous H1 histamine receptors. Fluorescence was collected (using SoftMax Pro, Molecular Devices) and calibrated to cytosolic free Ca2+ concentration ([Ca2+]c) as described63 (link).
+ Open protocol
+ Expand
5

NKG2D and ULBP4 Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
NKG2D and ULBP4 were knocked down by RNA interference. For hNKG2D (AM16708A), the following Silencer siRNAs (Thermo Fisher Scientific) were used: 108247 (siRNA#1), 108248 (siRNA#2), 108249 (siRNA#3). Additionally, a 4th siRNA of the following sequence was used: 5′ – CGGGGUCAGGGAGGUGGUGUU - 3′ (9 (link)) (siRNA#4). The siRNAs used for ULBP4 (4392420) were s43926 (siRNA#1) and s43928 (siRNA#2) (Thermo Fisher Scientific). The silencer negative control siRNA (AM4611) (Thermo Fisher Scientific) was used for comparison. The siRNAs (5nM) were transfected into the NK cells using a Nucleofector II (Lonza) following the manufacturer’s instructions. Twenty-four hours following transfection, the cells were analyzed for NKG2D and ULBP4 surface expression and TNF-α release using flow cytometry and CBA, respectively.
+ Open protocol
+ Expand
6

Silencing Lrig1 in iTreg Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Silencer Select siRNAs targeting mouse Lrig1 (AM16708, 4390771) and negative control (AM4611, AM4613) were purchased from Thermo Fisher Scientific. In all, 1 × 106 cells of iTreg cells per nucleofection reaction were resuspended in Mouse T cells Nucleofector Solution (100 μl per nucleofection) (Lonza) at room temperature. In all, 50, 150 nM of Lrig1 siRNA (siLrig1) or 150 nM of control siRNA (siControl) was combined with 100 μl of the cell suspension and transferred into the nucleocuvettes of the 4D-Nucleofector X unit (Lonza). The Nucleocuvettes were placed into the 4D-Nucleofector X unit and pulsed with the Nucleofector program DN-100. The nucleocuvettes were incubated for 10 min at 37 °C, 5% CO2, and then resuspended with RPMI 1640 medium. After 24 h post nucleofection, siRNA-treated iTreg cells were stained with relevant antibodies to confirm the expression level of markers. The cells were co-cultured with eFlour 670-stained effector T cells for the suppression assay, followed by flow cytometric analysis. To measure the cell proliferation capacity, siRNA-treated iTreg cells were cultured with IL-2 (20 ng ml−1) for 72 h. Cell proliferation of each group was quantified with the gate by Flowjo V10.
+ Open protocol
+ Expand
7

POU5F1 siRNA Delivery via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols
POU5F1 (AM16708) and negative control siRNAs (AM4611) were purchased from Thermo Fisher Scientific and diluted to 10 μM in nuclease-free water to serve as the delivery cargo. Cells were seeded into the LEPD wells 24 hours before electroporation, and the siRNAs were delivered using the localized electroporation protocol described in the “General electroporation protocol for delivery and sampling” section.
+ Open protocol
+ Expand
8

Cell Culture and Genetic Manipulation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human BT-549 TNBC, A549 (mutant KRAS) NSCLC, H460 (mutant KRAS) NSCLC and embryonic kidney HEK293 cells were cultured in RPMI1640 medium (ATCC, Manassas, VA, USA). MDA-MB-231 (mutant KRAS) TNBC cells were grown in Dulbecco’s modified Eagle’s medium (Corning, Manassas, VA, USA). PC-3 prostate cancer cells were grown in F-12K medium (ATCC). MCF-10A cells were cultured in MEGM medium (Lonza, Walkersville, MD, USA). Media were supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin. Cell authentication was performed by short tandem repeat analysis. Cells were monitored for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, MA, USA). Cells stably expressing a control scrambled shRNA (CshRNA), MUC1shRNA, ZEB1shRNA, DNMT3bshRNA, empty vector or MUC1-C were generated as described (30 (link)–32 (link)). Cells were transfected to express a control siRNA (AM4611; ThermoFisher Scientific, Waltham, MA, USA) or RASSF1A siRNA (AM16708; ThermoFisher Scientific) in the presence of Lipofectamine RNAimax reagent (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
9

Downregulation of IL32 and PLA2G2A in Liver Cell Models

Check if the same lab product or an alternative is used in the 5 most similar protocols
For downregulation experiments, 30nM of negative control scramble (SCR siRNA) (AM4611, Thermo fisher scientific), IL32 siRNA (mixt of s17656, s17657 and s17658 (1:1:1, total 30nM), Thermo Fisher scientific) or PLA2G2A siRNA (mix of s10589, s10591 and s224271, s17658 (1:1:1, total 20nM) Thermo Fisher Scientific) was transfected with Lipofectamine 3000, as per manufacturer’s instructions. For 2D culture, transfection was performed 24 h after seeding cells and cells were transfected for 48 h till endpoint analyses. For spheroids, transfection mix was supplemented in the media at the time of seeding to facilitate maximum uptake of siRNA. HepG2+ LX-2 spheroids were grown for 96 h till harvesting endpoint, while PHH and PHH + PHHSC spheroids were left to form for 7 days until endpoint analysis. Even with media changes, no additional transfections were performed. RNA from cells and spheroids were extracted with the RNeasy Plus Mini Kit (Qiagen) and reverse transcribed using high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Gene expression was assessed by Real-Time qPCR using master mix (Life Technologies) and TaqMan probes for IL32 and PLA2G2A according to the manufacturer’s protocol. All reactions were performed in triplicate. Data were analyzed using the 2−ΔΔCt method normalized to beta actin.
+ Open protocol
+ Expand
10

Investigating TFF3 knockdown in A549 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 cells (1×105) seeded into six-well culture plates were transfected with TFF3-targeting siRNA (Silencer Select s14039, s14040 and s14041; Thermo Fisher Scientific, Inc.) or non-targeting control siRNA (AM4611; Thermo Fisher Scientific, Inc.) using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific, Inc.) at a final concentration of 50 nM. Cells were subjected to the immunoblotting analysis and matrigel invasion assay 72 h after siRNA transfection.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!