Vacuum prep workstation

Genomic DNA from the human tissues was extracted using the Blood and Tissue DNA Kit (Qiagen, Hilden, Germany) and was subjected to bisulfite treatment using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer's instructions. Next, the genomic DNA samples were PCR amplified and the site‐specific methylation levels were quantified via pyrosequencing analysis. Briefly, the sequencing samples were first prepared using the Vacuum Prep workstation (Biotage, Uppsala, Sweden) and then were transferred to a plate harboring 0.4 μmol/L of sequencing primers in 40 μL of annealing buffer, followed by heating at 80°C for 2 minutes. Pyrosequencing analysis was performed using the PyroMark Gold Q96 Reagent and PyroMark ID System (Qiagen), and the results were analyzed using Pyro Q‐CpG™ software v. 1.0.9 (Sangon Biotech, Shanghai, China). The primer sequences of the pyrosequencing analysis are listed as follows:
Primer 1: F 5′‐GTTAAAAGTATGTAYGATGTGTGTGG‐3′
R 5′‐ATAACAACAAAAACCACAAAACC‐3′
Primer 2: F 5′‐TTGTTGGGGTTGAAYGAGTTAAG‐3′
R 5′‐AACACACAAAAATCCTAACTACCAC‐3′

HUVECs were plated on 100-mm plates (2–5 × 10⁵ cells/cm²) and cultured to 80%–90% confluence. The culture medium was changed to untreated control medium or medium containing 50 multiplicity of infection (MOI) Ad-DNMT3B for 48 h, 5 μM 5-aza-2′-deo- xycytidine (5-aza-dC) for 72 h, 40 μg/mL ox-LDL or 1mM N-acetylcysteine (NAC) for 24 h respectively. Genomic DNA was extracted and modified by bisulfite treatment, which converts all unmethylated cytosines to uracil, using the EpiTect bisulfite kit (Qiagen, Valencia, CA, USA), according to the manufacturer's instructions. PCR products from bisulfite-treated genomic DNA samples were analyzed using pyrosequencing technology to quantify site-specific methylation. Sequencing samples were prepared using a Vacuum Prep workstation (Biotage AB, Uppsala, Sweden). Pyrosequencing was performed using the PyroMark Gold Q96 Reagent and the PyroMark ID system (Qiagen, Germany). The sequencing primers used are listed in Supplemental Table 2. During assay design, Pyro Q-CpG™ software v. 1.0.9 was used to determine the optimal order of nucleotide addition. This software also automatically analyzed the methylation results. The pyrosequencing analysis was performed at Sangon Biotech Co., Ltd. (Shanghai, China).

The PCR program consisted of a denaturing step of 3 min at 95°C followed by 45 cycles of 15 s at 95°C, 20 s at 54°Cand 30 s at 72°C, with a final extension of 5 min at 72°C.
The pyrosequencing samples were prepared using the Vacuum Prep workstation (Biotage AB, Uppsala, Sweden). The biotinylated amplicons were immobilized onto streptavidin Sepharose beads in the following reaction system:40 μl of the amplicon, 3 μl of streptavidin Sepharose HP beads (GE Healthcare), 37 μl of binding buffer [10 mM Tris-HCl, 2 M NaCl, 1 mM EDTA, 0.1% Tween-20, and Milli-Q (18.2 MΩ x cm) water,pH 7.6] and 15 μl of Milli-Q water. After one denaturation step and two washing steps using the Vacuum Prep workstation, the amplicons were transferred to a plate containing 0.4 μM sequencing primer in 40 μl of annealing buffer (20 mmol/l Tris-acetate and 2 mM magnesium acetate, pH 7.6). Pyrosequencing was performed using the PyroMark Gold Q96 Reagent and the PyroMark ID system (Qiagen, Germany), and sequences were analyzed with the Pyro Q-CpG™ software v. 1.0.9.PCR and sequencing primers were synthesized based on previously reported sequences[29 (link),30 (link)].