Supreme nzytaq dna polymerase

Total RNA from hemi-hippocampi homogenates was extracted by using the NZY total RNA isolation kit (NZYTech, Lisboa, Portugal) following the company’s datasheet. The total RNA was measured by Nanodrop 1 000 spectrophotometer (Thermo Fisher Scientific, MD, USA), so, 1 µg of RNA was reverse transcribed to obtain cDNA by using oligo(dT) and random primers of the first-strand cDNA synthesis kit (NZYTech, Lisboa, Portugal). All PCRs were performed using supreme NZYTaq DNA polymerase (NZYTech, Lisboa, Portugal) with specific primers (Sigma-Aldrich, Milan, Italy) for tumor necrosis factor-α (TNF-α, forward primer 5′-CAGCCGATGGGTTGTACCTT-3′ and reverse primer 5′-CCGGACTCCGCAAAGTCTAA-3′), interleukin-1β (IL-1β, forward primer 5′-GGACCCCAAAAGATGAAGGGC-3′ and reverse primer 5′-GGAAAAGAAGGTGCTCATGTCC-3′), and IL-10 (forward primer 5′-GCCCTTTGCTATGGTGTCCT-3′ and reverse primer 5′-CTCTGAGCTGCTGCAGGAAT-3′). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, forward primer 5′-GCTACACTGAGGACCAGGTTGTC-3′ and reverse primer 5′-CCATGTAGGCCATGAGGTCCAC-3′) was used as reference gene.

Genomic DNA was extracted as previously described [57 (link)]. Amplification of the full-length 16S rRNA gene was performed by polymerase chain reaction (PCR) with universal primers 27F (5′-GAGTTTGATCCTGGCTCAG) and 1525R (5′–AGAAAGGAGGTGATCCAGCC) [58 (link)]. PCR reactions were carried out with Supreme NZYTaq DNA polymerase (NZYTech, Portugal) with 30 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C. Products were purified using JET Quick PCR Purification Spin Kit (Genomed GmbH, Germany) according to manufacturer’s instructions and sequenced at GATC Biotech (Germany). 16S rRNA gene sequences were compared with sequences at the NCBI database using the BLAST tool (http://blast.ncbi.nlm.nih.gov/) and assignment to species level considered nucleotide sequence identities of ≥99%. For species identity validation, DNA from Mycobacterium isolates was used for PCR amplification of partial sequences of rpoB and hsp65 genes with mycobacterial-specific primers GrpoB1 (5′-ATCGACCACTTCGGCAACCGCC), GrpoB2 (5′-GGTACGGCGTCTCGATGAASCCG), and Tb11 (5′-ACCACGATGGTGTGTCCAT), Tb12 (5′-CTTGTCGAACCGCATACCCT), respectively [59 (link)]. PCR reactions were carried out with KOD Hot-Start DNA polymerase (Novagen) according to manufacturer’s instructions and PCR products were purified and sequenced, as described above.

Amplification of a nearly full-length 16S rRNA gene sequence from bacterial isolates was performed by PCR with primers 27F (5′ – GAG TTT GAT CCT GGC TCA G – 3′) and 1525R (5′ – AGA AAG GAG GTG ATC CAG CC – 3′) [31] . The PCR reaction mix (50 µl) contained: reaction buffer (1.5 mM MgCl₂, 50 mM KCl and 10 mM Tris-HCl, pH 8.3), 100 µM (each) deoxynucleoside triphosphates (NZYTech, Lisbon, Portugal), 0.2 µM (each) primer and 1.5 U Supreme NZYTaq DNA polymerase (NZYTech). The PCR was performed with 30 cycles: 1 min at 94°C, 1 min at 53°C, and 1 min at 72°C.PCR products with 1,500 bp obtained from isolates were purified using the NZYGelpure kit (NZYTech) according to the manufacturer's instructions, and sequenced as described below.