The largest database of trusted experimental protocols

Sigenome risc free control sirna

Manufactured by Horizon Discovery
Sourced in United Kingdom

The SiGENOME RISC-Free Control siRNA is a laboratory tool designed for use in RNA interference (RNAi) experiments. It serves as a negative control, providing a baseline for comparison to evaluate the effects of target-specific siRNA in cell-based assays.

Automatically generated - may contain errors

10 protocols using sigenome risc free control sirna

1

Reverse-Transfection and Knockdown of DNA Damage Sensors

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were reverse-transfected with Lipofectamine RNAiMax (Invitrogen) according to manufacturer's instructions using 10 nM small interfering RNA targeting Chk2 (Human CHEK2 siGENOME- SMARTpool M-003256-06-0005, Dharmacon), ATM (Human ATM siGENOME siRNA-SMARTpool M-003201-04-0005, Dharmacon) or a scrambled control sequence (si Ctrl; siGENOME RISC free control siRNA, Dharmacon). For DNA-PKcs (referenced as PRKDC), we prepared a pool with four individual ON-TARGET plus PRKDC siRNAs (LQ-005030-00-0005, Dharmacon) or tested these four siRNAs individually [44 ]. 24 hours after siRNA transfection, cells were transfected with FLAG or FLAG-HIC1 vectors and treated with etoposide 24 hours later as previously described [8 (link)].
+ Open protocol
+ Expand
2

Targeted siRNA Knockdown of hPCL3S

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three siRNAs specific for hPCL3S were designed: sihPCL3S-spe1 GCTCCAAGCAGAAGGGCCA; sihPCL3S-spe2 TGGAGACAGATAGCGCCTCT and sihPCL3S-spe3 GGTTTGGTGTCG GGAATAACGG.
DU145 or PC3 cells were reverse-transfected with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions using 10 nM small interfering RNA targeting hPCL3S or a scrambled control sequence (si Ctrl; siGENOME RISC free control siRNA, Dharmacon) [48 (link), 49 (link)].
Forty-eight (48) hours after siRNA transfection, cells were plated and analyzed for their cell proliferation and cell migration capacities using the Incucyte technology as described below.
To verify knockdown efficiency, aliquots of these cells were treated for RNA and protein extraction and analyzed by RT-qPCR and/or Western blotting for hPCL3S expression levels.
EZH2-specific siRNAs were obtained from Dharmacon.
+ Open protocol
+ Expand
3

Genetic Knockdown of ALDH1A1 and ALDH1A3

Check if the same lab product or an alternative is used in the 5 most similar protocols
ALDH1A1 (J-008722-06-0002) and ALDH1A3 (J-009082-07-0002) On-Target plus siRNAs and siGenome RiSC-Free control siRNA (D-001220-01) were from Dharmacon (Lafayette, CO). SiRNA sequences were as follows: ALDH1A1: GAACAGUGUGGGUGAAUUG; ALDH1A3: UGAAUACGCUUUGGCCGAA. Cells were transfected with 200 pmol/ml siRNAs using Lipofectamine 3000 (Life Technologies) according to the manufacturer’s instructions. 48 hours after transfection, cells were collected and analyzed56 (link).
+ Open protocol
+ Expand
4

Autophagy Regulation by siRNA and Pharmacological Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiRNAs were diluted in Lipofectamine RNAiMAX transfection reagent (Invitrogen) and incubated for 15 min at room temperature before being added to cells in fresh culture medium. Invalidation of atg5 was performed using 25 nM of a pool of four siRNAs (M-004374-04-0005, Dharmacon (Lafayette, LA, USA), Target sequences: 5′-GGAAUAUCCUGCAGAAGAA-3′—5′-CAUCUGAGCUACCCGGAUA-3′—5′-GACAAGAAGACAUUAGUGA-3′—5′-CAAUUGGUUUGCUAUUUGA-3′) or two different siRNAs from the on-target plus set of four siRNAs (LU-004374-00-0005, Dharmacon, Target sequences: #7: 5′-GGCAUUAUCCAAUUGGUUU-3′—#10: 5′-ACAAAGAUGUGCUUCGAGA-3′). A non-targeting siRNA pool (siGENOME RISC-Free Control siRNA, Dharmacon) was used as a control. Transfections were stopped after 24 h by renewing the culture medium.
3-MA (Sigma-Aldrich, St. Louis, MO, USA; M9281) and Bafilomycin A1 from Streptomyces griseus (B 1793), respectively, diluted in water and DMSO, were directly added to the culture medium at 1 or 5 mM for 3 MA and 5 nM for Bafilomycin and let to react for 48 h.
+ Open protocol
+ Expand
5

Silencing DNMT1 in RCC4-VHL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ON-TARGETplus SMARTpool siRNA targeted to DNMT1 (Dharmacon, Austin, TX) and siGENOME RISC-Free Control siRNA (Dharmacon, Austin, TX) were used. RCC4-VHL cells grown on 10 cm tissue culture plates were transfected with control or DNMT1 siRNA at a final concentration of 200 nM using Oligofectamine as per manufactures instructions.
+ Open protocol
+ Expand
6

Microinjection of Mouse Zygotes with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
siGENOME RISC-Free Control siRNA (Dharmacon) and Silencer Select Pre-designed siRNAs against mouse ASPP2 (#4390771, siRNA s102092, Ambion) were resuspended in nuclease-free sterile water and used at 20 μM. For zygotes, 3 to 4-week-old CD-1 females (Charles River UK) were injected intraperitoneally with 5 IU of PMSG (Intervet) and 48 h later with 5 IU of hCG (Intervet), and were paired with C57Bl/6 J male mice (in house). Zygotes were retrieved from oviductal ampullae at 20 h post-hCG. Cumulus-enclosed zygotes were denuded by exposure to 1 mg/mL hyaluronidase (Sigma) in modified mHTF (Life Global) containing 3 mg/ml BSA for 3–6 min and cultured in LGGG-020 (life Global) containing 3 mg/ml BSA in the presence of 5% CO2 at 37 °C. Microinjection of zygotes commenced 2 h after release from cumulus mass. Zygotes with normal morphology were microinjected into the cytoplasm in 30 µl drops of modified HTF media containing 4 mg/ml BSA using a PMM-150FU Piezo impact drive (Primetech) using homemade glass capillaries with ∼5–10 pl of siRNA. Zygotes were returned to LGGG-020 containing 3 mg/ml BSA in the presence of 5% CO2 at 37 °C until analysis.
+ Open protocol
+ Expand
7

Silencing OGT and EZH2 in HCT116 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCT116 cells were reverse-transfected with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions using 5 nM small interfering RNA targeting OGT (siGENOME human OGT siRNA D-019111-01, Dharmacon), EZH2 (EZH2 siGENOME SMART Pool M-004218-03-0005, Dharmacon) or a scrambled control sequence (siCTRL; siGENOME RISC free control siRNA, Dharmacon) as previously described [19 (link)]. Seventy-two hours later, cells were harvested for RNA/protein extraction.
+ Open protocol
+ Expand
8

Molecular Signaling Pathway Analyses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies to YAP, TAZ, pAKTT308, pAKTS473, AKT, pP70S6KT389, P70S6K, pERK, Grb2, CTGF, pIGF1R, IGF1R, pGABT452, E-cadherin and β-catenin were from Cell Signaling Technology; pIRS1 and IRS1 from EMD Millipore; Erk2 from Santa Cruz Biotechnology and H3K9Me3 from Abcam.
IGF1 was from Upstate Biotechnology, EGF from Sigma and insulin from Gibco-BRL, and LPA (1-oleoyl-2-hydroxy-sn -glycero-3-phosphate) from Sigma or Avanti. Before use, LPA was solubilized in phosphate-buffered saline containing 1% fatty acid-free bovine serum albumin (Roche Molecular Biochemicals).
ON-TARGETplus SMARTpool siRNA libraries, ON-TARGETplus siRNA and siGENOME RISC-Free Control siRNA (D-001220-01) were from Dharmacon. YAP and TAZ plasmids were from Ju-Seog Lee (MD Anderson Cancer Center (MDACC)). X-tremeGENE HP DNA Transfection Reagent was from Roche Diagnostics.
+ Open protocol
+ Expand
9

NF-κB Signaling Pathway Regulation in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
GloResponse NF-κB-RE-luc2P HEK293 cells were seeded at 10,000 cells/well in 96-well plates. After 24 hr, cells were transfected with siRNA at a final concentration of 25 nmol/l with Dharmafect reagent #1. After 72 hr, cells were stimulated with TNF and analyzed by NF-κB luciferase reporter assay. For signaling pathway analysis, HEK293 cells at a density of 100,000 cells/well in 24-well plates were transfected as before and stimulated with TNF and lysed in the presence of protease and phosphatase inhibitor cocktail for immunoblot. Western blot gel electrophoresis, transfer, and detection was performed in parallel with identical film exposure duration. The following siRNA sequences were used: UBE2L3 sense 5′-CCGCAAAUGUGGGAUGAAA-3′, anti-sense 5′-UUUCAUCCCACAUUUGCGG-3′; HOIL-1 sense 5′-GCUCAGAUGCACACCGUCA-3′ and anti-sense 5′-UGACGGUGUGCAUCUGAGC-3′; HOIP sense 5′-GGCGUGGUGUCAAGUUUAA-3′ and anti-sense 5′-UUAAACUUGACACCACGCC-3′; and Sharpin sense 5′-CCUGGAAACUUGACGGAGA-3′ and anti-sense 5′-UCUCCGUCAAGUUUCCAGG-3′. siGENOME RISC-Free Control siRNA (Dharmacon) was used as a control.
+ Open protocol
+ Expand
10

Knockdown of HIC1 in HEK293T cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were reverse-transfected with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions using 10 nM small interfering RNA targeting HIC1 (Human, Dharmacon), or a scrambled control sequence (si Ctrl; siGENOME RISC free control siRNA, Dharmacon). 48 hours after siRNA transfection, cells were treated for RNA extraction [25 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!