Mkn 28

Human hepatocellular carcinoma cell line SMMC-7721, human gastric cancer cell lines SGC-7901 and MKN-28 were cultured in PRMI Medium 1640 (GIBCO BRL, Grand Island, NY, USA) with 10% fetal bovine serum (GIBCO BRL), penicillin (100 mg/ml) and streptomycin (100 mg/ml). Human colon cancer cell lines HT-29 were cultured in PRMI Medium 1640 with 20% fetal bovine serum. Human hepatocellular carcinoma cell line Huh7, human gastric adenocarcinoma cell line AGS, human colon cancer cell line HCT 116 and human embryonic renal epithelial cell line HEK293T were cultured in Dulbecco’s Modified Eagle Medium (GIBCO BRL) with 10% fetal bovine serum (GIBCO BRL), penicillin (100 mg/ml) and streptomycin (100 mg/ml). Human hepatocellular carcinoma cell line Huh7 and SMMC-7721 were obtained from the Type Culture Collection of the Chinese Academy of Sciences. Human gastric cancer cell lines SGC-7901 and MKN-28 were purchased from Genechem (Shanghai, China). Human gastric cancer cell line AGS, human colon cancer cell lines HT-29, HCT 116 and human embryonic renal epithelial cell line HEK293T cell line was purchased from ATCC (Manassas, VA, USA).

A human cell line derived from normal gastric mucosa (GES‐1) and the GC cell lines SGC‐7901, BGC‐823, AGS, MKN‐27, MKN‐28 and MGC‐803 were purchased from GeneChem. Cell lines were cultured in RPMI‐1640 medium supplemented with 10% foetal bovine serum (FBS) and 100 µg/mL penicillin‐streptomycin in an atmosphere containing 5% CO₂ at 37°C. To generate GC cell lines stably expressing low levels of SPON2, we transfected GC cells with a lentivirus vector encoding a SPON2‐specific short hairpin RNA‐expressing (GeneChem) and a lentivirus encoding a random sequence of shRNA (negative control). The activities of the constructs were verified using Western blotting. The shSPON2 sequence was 5′‐CCGGCAGGGACAATGAGATTGTAGACTCGAGTCTACAATCTCATTGTCCCTGTTTTTG‐3′. SPON2 ectopic expression and negative control lentiviruses were also purchased from GeneChem, and the overexpressing cells were selected and used for next experiments. We transfected GC cell lines with pcDNA3.1A (−) CCND1 from Dr Xiong Yu (University of North Carolina Lineberger Comprehensive Cancer Center) and pcDNA‐ERK1/2 (GeneChem) in the presence of Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions. We verified the expression of each insert using Western blotting 48 hours before performing subsequent experiments.