To obtain DNA template for transcription for CLN3/BNI1 RNA, T7 promotor TAATACGACTCACTATAGGG was cloned to the 5′ of CLN3/BNI1. The plasmids were then digested with restriction enzymes in front of the T7 promotor and after CLN3/BNI1 to obtain DNA template that contained the T7 promotor-CLN3/BNI1. The DNA template was gel extracted (Qiagen) and eluted in RNAse-free water for in vitro transcription. In vitro transcription was done with HiScribe T7 high yield RNA synthesis kit (NEB) following protocols provided in kit. To transcribe labeled RNA for imaging, a trace amount of cy3-UTP was added into the mixture for transcription. Transcribed RNAs were then ethanol-precipitated and resuspended in RNase-free water and stored at −80 °C.
Gel extracted
Manufactured by Qiagen
Sourced in United Kingdom
Gel extracted is a laboratory equipment product designed to purify and extract DNA fragments from agarose gels. It provides a simple and efficient method to isolate and concentrate specific DNA sequences after electrophoresis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (1 mentions)
Takara genomic dna extraction kit, by Takara Bio (1 mentions)
Epitect bisulfite kit protocol, by Qiagen (1 mentions)
Miniprep kit, by Qiagen (1 mentions)
Hispeed plasmid maxiprep kit, by Qiagen (1 mentions)
Lb broth, by Thermo Fisher Scientific (1 mentions)
Pgem t easy kit, by Promega (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Dig rna labelling kit, by Roche (1 mentions)
3 protocols using gel extracted
1
Generating CLN3/BNI1 RNA for Imaging
2
OLFM4 Promoter Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from HGC27, SGC-7901 and MGC-803 cells with the TaKaRa Genomic DNA Extraction Kit (TaKaRa Co., China). Genomic DNA (1 μg per sample) was modified with bisulfite using the Epitect Bisulfite Kit Protocol (Qiagen) following the manufacturer's instructions, and the modified DNA was amplified using the following primers: OLFM4 forward, AAAGGTGTGTGAAATGTTGAG, and reverse, CTCTCCCCCATTTTACT. The PCR products were gel extracted (Qiagen) to confirm that a single band had been obtained and were then sequenced by Invitrogen.
3
Generating Digoxigenin-Labeled Riboprobes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) using specific primers (Sigma Aldrich; Table 4 ) amplified the required DNA fragment of the gene of interest using human brain foetal DNA as a template, which was run on a gel to confirm the correct size of the product. The band was gel extracted (Qiagen, Crawley, UK), and the DNA was cloned and transformed into competent cells using the pGEM®‐T Easy kit (Promega, Southampton, UK). Select colonies were grown in 5 mL LB‐Broth (Invitrogen, Paisley, UK) with ampicillin (overnight). Plasmids were prepared using the Miniprep kit (Qiagen) and the HiSpeed plasmid Maxiprep kit (Qiagen) before restriction digest using the Qiagen PCR purification kit. Digoxigenin‐UTP was incorporated into riboprobes during in vitro transcription using the DIG RNA Labelling Kit (SP6/T7; Roche, Indianapolis, USA) according to the manufacturer's instructions. Antisense and sense probes were generated using T7 and SP6 polymerase, respectively. Probe concentration was measured (Nanodrop; Thermo Scientific, Waltham, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!