Epoximicin

Assays were performed under reaction conditions and protein concentrations similar to proteasome activity assays. B20S proteasomes were incubated in reaction buffer with either PA28αβ, PA28γ, or PA28γ-K188E, and either epoximicin (100 nM) or leupeptin (40 μM) was subsequently added (epoximicin, Enzo Life Sciences; leupeptin, Sigma Aldrich). Assays were controlled for using replicates without inhibitors read simultaneously.

The following reagents were used: rabbit anti-AXIN1 (C95H11), rabbit anti-AXIN2 (76G6) (Cell Signaling Technology), mouse anti-β-catenin (BD Transduction Laboratories); mouse anti-ubiquitin (Upstate / Millipore), mouse anti-active-β-catenin (05–665, Millipore); mouse anti-β-Actin (Sigma Aldrich), mouse anti-Calreticulin (Enzo lifesciences), mouse anti-Vinculin (HVIN-1, Sigma Aldrich), rabbit anti-FoxM1 (C-20, Santa Cruz), mouse anti-LaminA (Abcam), rabbit anti-p62 (MBL / Nordic Biosite). All secondary antibodies used for confocal microscopy studies were obtained from Jacksons ImmunoResearch Laboratories and secondary antibodies used for Western blotting were obtained from LI-COR Biosciences GmbH. Hoechst (Invitrogen). G007-LK (Gift from Stefan Krauss and Jo Waaler, Oslo, Norway); MG132 (Calbiochem); Dimethyl sulphoxide (DMSO), 3-Methyladenine (3-MA), Lactacystin, PhosSTOP (Sigma Aldrich); Epoximicin (Enzo lifesciences); Leupeptin (Peptanova Gmbh, Peptide Insitute, Japan). Quantitech mRNA primer pairs against TBP (QT00000721), AXIN2 (QT00037639) and FoxM1 (QT00000140) were obtained from Qiagen. FoxM1 siRNA (Sense: 5' GGACCACUUUCCCUACUUUUU-3', Antisense: 5' AAAGUAGGGAAAGUGGUCCUU 3' [21 (link)], and control siRNA (cat: D-001810-01), Dharmacon. siRNA transfections were performed using RNAiMax (Invitrogen) according to the manufacturer's protocol.