Pcr2.1 topo ta cloning vector
The PCR2.1-TOPO TA cloning vector is a laboratory product designed for the cloning of PCR amplified DNA fragments. It provides a quick and efficient method for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector. The vector features topoisomerase I-activated linearized DNA, which allows for the direct ligation of PCR products.
Lab products found in correlation
22 protocols using pcr2.1 topo ta cloning vector
Characterization of Pro2 Antisense Transcripts
Characterization of Pro2 Antisense Transcripts
Lentiviral Overexpression of Transcription Factors and miRNAs
miR-204/211 and miR-218 were cloned into a PCR 2.1 TOPO TA cloning vector (Thermo Fisher Scientific) by using the following oligos flanked by the EcoRI recognition site: 204Fw: CCGGAGAATCAAGATGAGC; 204Rv: GTTATGGGCTCAATGATGG; 218Fw: GATCATACACAATCTGCGGGAAG; 218Rv: GGACATTTGTTATTCTCCCCTC.
RYR1 Exon 102 Sequencing Workflow
Viral CRISPR target region characterization
Characterization of Sole VKOR Genes
Cloning and Expression of OsMDHAR in Yeast
Plasmid Extraction and Allele Sequencing
Preparation of Antibiotic and Heavy Metal Solutions
Cloning and Sequencing of PCR Products
Wild-type (WT) construct was made with primer pair BcISt1c left/right for amplification before cloning. The deletion constructs Δ5′DR, Δ3′DR and ΔORFB were amplified by inverse PCR with outward primers (see Supplementary Table S2) from the WT plasmid construct as template using Pfu Turbo in order to remove specific IStron regions, and then ligated with T4 ligase (New England Biolabs). The various constructs were transformed into either E. coli xl-1 (recA+) or E. coli SCS110 (recA−) strains.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!