The largest database of trusted experimental protocols

C57bl 6j mouse embryos

Manufactured by Charles River Laboratories

C57BL/6J mouse embryos are a widely used inbred mouse strain that serves as a model for various research applications. These embryos are obtained from timed pregnancies of C57BL/6J female mice. They provide a standardized biological system for studying embryonic development, genetic modifications, and other areas of research.

Automatically generated - may contain errors

2 protocols using c57bl 6j mouse embryos

1

Culturing Primary Cortical Neurons from Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17. Cerebral cortices were dissected and enzymatically dissociated using trypsin with EDTA (Thermo Fisher Scientific; 10 min), mechanically dissociated in Minimum Essential Media (MEM; Fisher) supplemented with 0.6% glucose (Sigma) and 10% FBS (Hyclone) and stained to assess viability using Trypan Blue (Sigma). Neurons were plated on coverslips (Matsunami Inc, 22 mm). A total of 50,000 neurons were plated as a ‘spot’ on the center of the coverslip to create a small, high-density network. Neurons were cultured in standard growth medium (glial conditioned neurobasal plus medium [Fisher] supplemented with GlutaMAX [Gibco], and B27 plus [Invitrogen]), and half of the media was exchanged 2–3 times a week until the experiment endpoints. No antibiotics or antimycotics were used. Cultures were maintained in an incubator regulated at 37οC, 5% CO2, and 95% relative humidity as described (Valdez-Sinon et al., 2020 (link)). Cells were transiently transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
2

Upf2 Knockout in Excitatory Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). Upf2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the Upf2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT). Upf2-shRNA 2 virus is on a piLenti-shRNA-GFP backbone carrying four shRNAs against the Upf2 mRNA (TGAAAGACTATGTTATTTGTTGTATGATA). In experiments with Upf2 deletion in excitatory neurons, a Upf2 conditional knockout mouse line, which carries flanked loxP sites in the second exon of this gene, [1 ] was crossed with αCaMKII:CreERT2 line [2 ], and Upf2wt/wtCaMKII:CreERT2(CTRL) or Upf2fl/flCaMKII:CreERT2 (CKO) adults were used. To induce Cre, mice were treated with 200 mg tamoxifen/kg body weight every other day for five days. To outline dendrites and spines, an AAV-CaMKIIa-eGFP virus (Addgene; 50469-AAV5) was injected into the adult hippocampus of CTRL and CKO mice. All animal experiments were completed with the approval of Weill Cornell Medical College ethical committees and per Research Animal Resource Center (RARC) guidelines.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!