P foxo1 thr24

Manufactured by Cell Signaling Technology

Sourced in United States

P-FoxO1 (Thr24) is a laboratory reagent that detects the phosphorylation of the transcription factor FoxO1 at threonine 24. This phosphorylation event is involved in the regulation of cellular processes, but the specific details of its function are not provided in this factual description.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

P-FOXO1 (Thr24)/FOXO3 (Thr32) (2 citations) P-FoxO1 (58 citations) FOXO1 (243 citations)

6 protocols using p foxo1 thr24

Immunoblotting of Cell Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein samples were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes. After blocking with 5% non-fat milk in Tris-buffered saline Tween-20 (TBST), the membranes were incubated with primary antibodies against IL-17 (#AO688, Abclonal Technology, China), Foxp3 (#GB11093, Servicebio, China), phosphoinositide 3-kinase (PI3K) (#bsm-33219m, Bioss, China), phospho (p)-PI3K (Tyr317, #bs-5570R, Bioss, China), protein kinase B (Akt) (#GB11689, Servicebio, China), p-Akt (Ser473, #AF0908, Affinity, USA), FoxO1 (#GB11286, Servicebio, China), p-FoxO1 (Thr24, #9464T, Cell Signaling Technology, USA) or GLP-1R (#CSB-PA009514YA01HU, Cusabio, China) at 4℃ overnight. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies. Proteins were detected using an enhanced chemiluminescence system (Clinx Science Instruments, China).

Xu Q., Zhang X., Li T, & Shao S. (2022). Exenatide regulates Th17/Treg balance via PI3K/Akt/FoxO1 pathway in db/db mice. Molecular Medicine, 28, 144.

+ Open protocol

+ Expand

Culturing and Characterizing Breast Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 cells were grown in DMEM, and 67NR, 4T07, and 4T1 breast cancer cell lines were grown in RPMI supplemented with 10% (vol/vol) FBS, penicillin (100 units/ml), and streptomycin (100 μg/ml; Invitrogen, Rockville, MD). The four human breast cancer cell lines MCF10A1 (M-I), MCF10AT1k.cl2 (M-II), MCF10CA1h (M-III), and MCF10CA1a.cl1 (M-IV) were obtained from Dr. Anita Roberts (NCI/NIH, Bethesda, MD). M-I, M-II, M-III, and M-IV cells were grown in DMEM/F12 (Invitrogen, Carlsbad, CA) containing 5% horse serum (Invitrogen) at 37°C with 5% CO₂. M-I and M-II cells were supplemented additionally with 10 μg/ml insulin (Sigma, St. Louis, MO), 20 ng/ml epidermal growth factor (Sigma), 0.5 μg/ml hydrocortisone (Sigma), and 100 ng/ml cholera toxin (Sigma). Antibodies specific for APP (22C11) were purchased from EMD Millipore; APP (4G8) from Covance. Specific antibodies for p27(C-19) and p21 (F-5) were from Santacruz and anti-β-actin (AC-15) was from Sigma. Antibodies purchased from Cell Signaling were AKT (#9772), pAKT Thr308 (#4056), pAKT Ser473 (#9271), pFOXO1 Thr24 (#9464), pGSK3 Ser9 (#9336), pp65 Ser536 (#3033), pERK1/2 (#9101), β-Catenin (#9562), PARP (#9542), and cleaved Caspase-3 (#9661). Anti-survivin antibody (AB8228) was purchased from Abcam. The anti-CD44 antibody (#15675-1-AP) was from Proteintech group and anti-GSK3b (KAP-ST002E) antibody was from Stressgen.

Lim S., Yoo B.K., Kim H.S., Gilmore H.L., Lee Y., Lee H.P., Kim S.J., Letterio J, & Lee H.G. (2014). Amyloid-β precursor protein promotes cell proliferation and motility of advanced breast cancer. BMC Cancer, 14, 928.

+ Open protocol

+ Expand

Liver Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blots (WBs) were performed in liver samples homogenized in buffer A. Homogenates were centrifuged at 16 000 g for 15 min at 4 °C. Proteins were resolved in 10% or 15% acrylamide gels for SDS/PAGE and transferred to Immobilon membranes (Millipore, Sigma-Aldrich). The following antibodies were used: PEPCK (a kind gift from Dr. E. Beale); p-FoxO1 Thr24 (9464, Cell Signaling, Danvers, MA, USA); FoxO1 (9454, Cell Signaling); GK (peptide 414–428 raised by Sigma Genosys (Cambridge, UK)); p-AMPKβ Ser108 (4181, Cell Signaling); AMPKβ (4150, Cell Signaling); p-AMPKα Thr172 (2531, Cell Signaling); AMPKα (2532, Cell Signaling); p-AKT Thr308 (4056, Cell Signaling); p-AKT Ser473 (9271, Cell Signaling); AKT (9272, Cell Signaling); p-GSK3β Ser9 (9336, Cell Signaling); and GSK3β (sc7291, Santa Cruz, Dallas, TX, USA). Proteins were detected by the ECL method (Immobilon Western Chemiluminescent HRP Substrate, Millipore, Sigma-Aldrich). Loading control of the WB membrane was performed using the REVERT total protein stain.

López-Soldado I., Bertini A., Adrover A., Duran J, & Guinovart J.J. (2020). Maintenance of liver glycogen during long-term fasting preserves energy state in mice. FEBS letters, 594(11), 1698-1710.

+ Open protocol

+ Expand

Regulation of Clock Proteins by p62

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flag-Bmal1, HA-Bmal1, Flag-Clock and Flag-ClockΔ19 were subcloned into the pCMV10 3xFlag DNA vector (Sigma) for protein expression. Myc-p62 and Myc-p62ΔUBA mutant constructs were previously described55 (link). Flag-p62 was subcloned into the pcDNA3.1 (Invitrogen). Site-directed mutagenesis of Bmal1 K259R construct clone was performed using the following primers.
Bmal1 K259R-F: TGCAACAGGCCTTCAGTACGGGTGGAAGATAAGGACTTC;
Bmal1 K259R-R: GAAGTCCTTATCTTCCACCCGTACTGAAGGCCTGTTGCA. All constructs were verified by sequencing. The primary antibodies used in the study are: Flag-tag (Sigma-Aldrich), Myc-tag, AKT, pAKT (Ser473), S6K, pS6K (Thr389) and FOXO1, pFOXO1 (Thr24) (Cell Signaling), BMAL1 (Cocalico, epitope: aa 381–579), CLOCK (Santa Cruz), LC3B (Novus), p62/SQSTM1 (Boster), REV-ERBα (Cell Signaling), PER256 (link), GADPH (Ambion), α-Tubulin (Santa Cruz) and Lamin B1 (Abcam). 3-methyladenine, MG132, chloroquine, and cycloheximide were purchased from Sigma-Aldrich.

Jeong K., He B., Nohara K., Park N., Shin Y., Kim S., Shimomura K., Koike N., Yoo S.H, & Chen Z. (2015). Dual attenuation of proteasomal and autophagic BMAL1 degradation in ClockΔ19/+ mice contributes to improved glucose homeostasis. Scientific Reports, 5, 12801.

+ Open protocol

+ Expand

Protein Analysis in Gastrocnemius Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gastrocnemius muscle tissues (0.03 g) were homogenized in 300 μL RIPA buffer (150 mM sodium chloride, 50 mM Tris-HCl, 1% nonidet P-40 (NP-40), 0.5% sodium deoxycholate, and 0.1% SDS) to determine protein levels of atrogin-1 (Cat #: AP2041, ECM biosciences, Versailles), MuRF1 (Cat #: MP3401, ECM biosciences), p-AktSer473 (Cat #: 4060, Cell Signaling Technology)/Akt (Cat #: 4691, Cell Signaling Technology), p-FoxO1Thr24 (Cat #: 9464, Cell Signaling Technology)/FoxO1 (Cat #: 9454, Cell Signaling Technology), p-mTORSer2448 (Cat #: 5536, Cell Signaling Technology)/mTOR (Cat #: 2983, Cell Signaling Technology), p-p70S6KThr389 (Cat #: 9234, Cell Signaling Technology)/p70S6K (Cat #: 9202, Cell Signaling Technology), p-4E-BP1Thr37/46 (Cat #: 2855, Cell Signaling Technology)/4E-BP1 (Cat #: 9644, Cell Signaling Technology), p-RBSer807/811 (Cat #: 8516, Cell Signaling Technology)/RB (Cat #: 9309, Cell Signaling Technology), proliferating cell nuclear antigen (PCNA, cat #: ab29, Abcam), type IIa myosin heavy chain (MyHC, cat #: sc-53095, Santa Cruz Biotechnology), E2F-1 (Cat #: sc-251, Santa Cruz Biotechnology), Cyclin D (Cat #:sc-8396, Santa Cruz Biotechnology), CDK4 (Cat #: sc-23896, Santa Cruz Biotechnology), and GAPDH (Cat #: sc-47724, Santa Cruz Biotechnology) in muscle tissues by western blotting as described in detail previously [8 (link)].

Hsu T.H., Wu T.J., Tai Y.A., Huang C.S., Liao J.W, & Yeh S.L. (2023). The combination of quercetin and leucine synergistically improves grip strength by attenuating muscle atrophy by multiple mechanisms in mice exposed to cisplatin. PLOS ONE, 18(9), e0291462.

+ Open protocol

+ Expand

Resveratrol's Lipid-Regulating Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols

Resveratrol was purchased from Yixin Pharm, Inc. (Zhejiang, China); The triglyceride (TG) kit, total cholesterol (TC) kit, low density lipoprotein cholesterol (LDL-C) kit, high density lipoprotein cholesterol (HDL-C) kit, superoxide dismutase (SOD) kit, malonaldehyde (MDA) kit, free fatty acid (FFA) kit, reactive oxygen species (ROS) kit, glutathione (GSH) kit, glutathione peroxidase (GPx) kit, and the coomassie brilliant blue kit were purchased from Jiancheng Bioengineering Institute (Nanjing, China); rabbit anti-mouse p47phox polyclonal antibody was purchased from LifeSpan Biosciences, Inc. (WA, USA); rabbit anti-mouse Sirt1 monoclonal antibody and the gp91phox polyclonal antibody were procured from Abcam, Inc. (Cambridge, UK); Adipose triglyceride lipase (ATGL), hormone-sensitive lipase (HSL), and p-HSL (Ser660) antibodies were purchased from Santa Cruz Biotech (Texas, USA); the primary antibodies including rabbit anti-mouse AMPK, p-AMPK (Thr172), FOXO1, and p-FOXO1 (Thr24) were purchased from Cell Signaling Technology (MA, USA); GAPDH antibody was obtained from Boster, Inc. (Wuhan, China); the BCA kit and HRP-labeled goat anti-rabbit secondary antibody were from Beyotime, Inc. (Jiangsu, China).

Zhu W., Chen S., Li Z., Zhao X., Li W., Sun Y., Zhang Z., Ling W, & Feng X. (2014). Effects and mechanisms of resveratrol on the amelioration of oxidative stress and hepatic steatosis in KKAy mice. Nutrition & Metabolism, 11, 35.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!