Full length cDNA of wild-type human PABPC4L (NCBI Reference Sequence: NM_001114734.2) was amplified from human adult brain cDNA using forward primer containing XhoI site:5′-CACCCTCGAGACATGAATGTAGCAGCCAAGTACC -3′ and reverse primer containing XmaI site5′-ATATCCCGGGCTAGTGTCTCTGGGCCAAGG -3′ (PABPC4L specific sequence is underlined). PCR product was digested with XhoI and XmaI and inserted into pmCherry-C1 vector (Clontech). PABPC4L cDNA clone carrying the c.C811T variant encoding p.R271X was generated using Phusion Site-Directed Mutagenesis Kit (Thermo Fischer Scientific Inc.) and mutagenic primer AGAAAGTCGAGT GACAGGCTGAG (variant position is underlined) according to manufacturer’s instructions. Flag-tagged PABPC4L constructs was generated with PCR using forward primer containing the FLAG tag encoding sequence GACTACAAAGACGATGACGACAAG containing HindIII site. Construct encoding G3BP1 (peGFP-C1-G3BP1) was kindly provided by Nancy Kedersha (Brigham and Women’s Hospital, Boston, MA)24 . Plasmids were purified with GeneJET Plasmid Midiprep Kit (Thermo Fischer Scientific Inc.). Clones generated by PCR were confirmed by direct sequencing.
Genejet plasmid midiprep kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The GeneJET Plasmid Midiprep Kit is a laboratory product designed for the purification of plasmid DNA from bacterial cultures. The kit utilizes a silica-based membrane technology to efficiently isolate and purify plasmid DNA from bacterial cells.
Automatically generated - may contain errors
Lab products found in correlation
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (3 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
Zymoprep yeast plasmid miniprep 2 kit, by Zymo Research (2 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions)
Pmcherry c1 vector, by Takara Bio (1 mentions)
Phusion site directed mutagenesis kit, by Thermo Fisher Scientific (1 mentions)
Maxiprep, by Thermo Fisher Scientific (1 mentions)
Picogreen dsdna quantification assay, by Thermo Fisher Scientific (1 mentions)
Clonexpress 2, by Vazyme (1 mentions)
Bamh 1 and not 1, by New England Biolabs (1 mentions)
Hydroxyurea, by Merck Group (1 mentions)
Mirin, by Merck Group (1 mentions)
Cisplatin, by Merck Group (1 mentions)
Nucleobond xtra midi kit, by Macherey-Nagel (1 mentions)
F actin, by Cytoskeleton (1 mentions)
Rhodamine phalloidin, by Cytoskeleton (1 mentions)
T4 polynucleotide kinase, by New England Biolabs (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
16 protocols using genejet plasmid midiprep kit
1
Generation and Validation of PABPC4L Variant Constructs
2
Arabidopsis Protoplast Transformation in 96-well Plate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protoplasts were generated from 3-day-old Arabidopsis Col-0 dark-grown cell suspension culture, and the transformations were carried out in small scale in 96 well plates with round-bottom (Roth) as previously described [30 (link)] using a Liquidator96 Manual Pipetting system (Steinbrenner GmbH, Germany). The DNA was purified using either the Gene JET Plasmid Midiprep kit or the Maxiprep version (Thermo Scientific), eluting in water and adjusting the final concentration to 1μg/μl.
3
Ampicillin-resistant Plasmid Isolation for HPV Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ampicillin resistant plasmids for HPV6, 11, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 66 were kindly provided by the HPV Reference Center, Karolinska Institutet, Sweden. Plasmids were transformed into heat-competent NEB 5-alpha E. coli (High Efficiency) (New England Biolabs) according to the manufacturer’s protocol and the cell suspension was subsequently plated on MH agar plates containing ampicillin. Plates were incubated overnight at 37°C and single colonies were transferred to liquid LB medium containing ampicillin. Cultures were grown while shaking to OD600 = 2–3, and then centrifuged at 5000g for ten minutes. Plasmid was isolated from cell pellets using GeneJet Plasmid Midiprep kit (Thermo Scientific) according to the manufacturer’s protocol. Isolated plasmid was eluted in 40μl elution buffer and quantitated in triplicate in three individual experiments to minimize assay variation using PicoGreen dsDNA quantification assay (ThermoFisher).
4
Engineered Mitochondrial Localization of PCK2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mitochondrial location vector pDsRED2-Mito (pDRM) was purchased from Waryong Biotechnology (Beijing, China). Homologous recombination was performed to clone PCK2 coding sequences into pDRM, according to the instructions of the one-step cloning kit ClonExpress II (Vazyme, Nanjing, China). Briefly, pDRM was linearized by restriction enzyme BamH I and Not I (NEB, Ipswich, MA, USA). PCK2 mRNA sequence was cloned using primers containing BamH I and Not I restriction sites and homologous sequences with the terminal sequences of linearized vector at the 5′-end (Suppl. Table S1 ). Then the linearized vector and the PCK2 coding sequences were ligated using ligase Exnase II supplied by the kit, and the ligation product was transfected into DH.5α. The monoclonal was picked, and pDRM-PCK2 vectors were purified using GeneJET Plasmid Midiprep Kit (Thermo Fisher, Waltham, MA, USA) and verified by sequencing.
5
Targeted Deletion of ZtvelB Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A knock-out vector for targeted deletion of ZtvelB (pΔztvelB) was constructed using yeast-based homologous recombination. The primers used to generate pΔztvelB are listed in Supplementary Table S2 and Supplementary Figure S1 . The pΔztvelB vector consisted of a pCAMBIA0380_YA (yeast-adapted) backbone, with the Hygromycin-trpC resistance cassette from pCB1003 (Carroll et al., 1994 (link)) flanked by two 1.5 kb regions targeting the ZtvelB locus. The flanking regions and Hygromycin-trpC resistance cassette were amplified using Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific).
A ZymoprepTM Yeast Plasmid Miniprep II kit (Zymo Research) was used to recover plasmid DNA from Saccharomyces cerevisiae, rescued into Escherichia coli ccdB or DH5α cells and isolated using the Gene JET Plasmid Miniprep Kit (Thermo Fisher Scientific) or Gene JET Plasmid Midiprep Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Correct plasmid assembly was initially confirmed by PCR and further confirmed by sequencing, using the primers detailed inSupplementary Table S2 and Supplementary Figure S1 .
A ZymoprepTM Yeast Plasmid Miniprep II kit (Zymo Research) was used to recover plasmid DNA from Saccharomyces cerevisiae, rescued into Escherichia coli ccdB or DH5α cells and isolated using the Gene JET Plasmid Miniprep Kit (Thermo Fisher Scientific) or Gene JET Plasmid Midiprep Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Correct plasmid assembly was initially confirmed by PCR and further confirmed by sequencing, using the primers detailed in
6
DNA Damage Repair Inhibitors Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MRE11 inhibitor Mirin was from Sigma-Aldrich. The NSC-105808 DNA2 inhibitor was a gift from Gregorz Ira24 (link). The DNA2 inhibitor was used at a concentration of 0.3 μM for 24 h. Hydroxyurea (Sigma-Aldrich) was dissolved in double-distilled H2O to obtain a 100 mM (7.6 mg ml−1) solution. Cisplatin (Sigma-Aldrich) was dissolved in PBS 10× to obtain a 5 mM stock. UV-C was used at 40 mJ cm−2 as described in the labeling scheme. The MUS81 vectors used for the genetic complementation experiments was a gift from by Ian Hickson33 (link). All vectors were amplified in DH5α Escherichia coli and extracted with GeneJET Plasmid Midiprep Kit (ThermoFisher Scientific).
7
Transient GUS and BiFC Assays in Arabidopsis Protoplasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transient GUS (ß-glucuronidase) reporter gene assays and BiFC were performed in protoplasts, which were derived from cell suspension culture cells of Arabidopsis thaliana Col-0 and in leaf protoplasts of Col-0, erf4 and esp/esr knock-out mutants. They were transfected with plasmid DNA purified with the Gene JET Plasmid Midiprep kit (Thermo Scientific) for GUS Assays or the Nucleo-Bond Xtra Midi kit (Macherey-Nagel, Düren, Germany) for BiFC. Protoplasts were transiently transformed with different concentrations of the respective plasmid DNA following the protocol published in Reference [36 ]. For details, see the protocol on http://www.zmbp.uni-tuebingen.de/c-facilit/plant-transformation.html .
8
Fluorescence-based Cytoskeletal Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F-actin was stained with rhodamine-phalloidin, which was purchased from Cytoskeleton, Inc. DAPI was purchased from Thermo Fisher Scientific. LPA was purchased from Avanti Polar Lipids, Inc. Restriction enzymes were purchased from either New England Biolabs, Inc. or Promega. The QuikChange kit was purchased from Agilent Technologies. Phusion DNA polymerase, T4 DNA ligase, and T4 polynucleotide kinase were also purchased from New England Biolabs, Inc. All other chemicals were from Sigma-Aldrich unless otherwise specified. The Wizard SV Gel and PCR Clean-Up system was from Promega. The GeneJet Plasmid Midiprep kit was from Thermo Fisher Scientific.
9
Transient Plasmid Transfection in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare plasmids for transfection, plasmids were transformed into chemically competent bacteria and isolated from cultures using the GeneJET Plasmid Midi-prep Kit (Thermofisher Scientific, K0481) or the PureLink HiPure Plasmid Maxiprep Kit (Thermofisher Scientific, K2100006). Plasmids were transiently transfected into HEK293T cells using TransIT-293 (Mirus Bio, MIR 2700) according to the manufacturer's instructions. To summarize, on day 1, HEK293T cells were plated in a 12-well plate (Fisher Scientific, #353043) at a density of 3x105/well in 1 mL of complete HEK medium to achieve approximately 60-70% confluency on Day 2. On Day 2, the transfection mixture was prepared in a total volume of 100 μL using 1 ug (X μl) of plasmid DNA (plasmid concentrations between 300ng and 1000ng/μl), diluted with optiMEM (Gibco, #31985-070) (97-X μl), and 3 μL of TransIT-293 reagent. While incubating the DNA:lipid complexes, the cells were washed using 500 μL of DPBS (Fisher Scientific, BW17-512F), incubated with 1 mL transfection medium (complete HEK medium without antibiotics), and replaced in the 5% CO2 incubator. Once the DNA:lipid complexes had incubated, the 100 μL mixture was added to the appropriate well, the plate gently shaken back and forth and then replaced in the incubator. On Day 4, cells were used in the aggregation assay.
10
Purification and Analysis of DnaA Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains, plasmids and proteins used in this work are listed in Table S1 . The primer sequences used in this study are listed in Table S2 . The genomic DNA of A. butzleri RM4018, S. denitrificans DSM 1251, and W. succinogenes DSM 1740 were used as templates to amplify DNA fragments for cloning. E. coli was grown at 30 or 37°C on solid or in liquid Luria-Bertani medium supplemented with 100 μg/ml ampicillin or 50 μg/ml kanamycin when necessary. Plasmids and DNA fragments were purified using a GeneJET Gel Extraction Kit, GeneJET Plasmid Miniprep Kit, GeneJET Plasmid Midiprep Kit (Thermo Scientific), or Plasmid Midi AX (A&A Biotechnology). DnaA proteins were purified as described in (Zawilak-Pawlik et al., 2006 (link)) with minor modifications (Supplementary Materials). In all subsequent analyses DnaA was supplemented with 3 mM ATP (electron microscopy) or 5 mM ATP (footprinting and P1 nuclease assay).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!