Pqcxih myc yap

Plasmids pCMV-myc-MST1 (Addgene #8847 from Joseph Avruch’s lab)^{57 (link)}, pCMV2-FLAG-SAV1 (Addgene #18970 from Marius Sudol’s lab)^{58 (link)}, pcDNA3-HA-MOB1 (Addgene #32835 from Kunliang Guan’s lab)^{14 (link)}, p2xFLAG-CMV2-LATS1 (Addgene #18971 from Marius Sudol’s lab)^{58 (link)}, and pQCXIH-Myc-YAP (Addgene #33091 from Kunliang Guan’s lab)^{14 (link)} were used. GFP-expressing vector was used as control.

siRNA transfections were performed using Lipofectamine RNAiMAX transfection reagent according to the manufacturer's instructions. Allstars negative control siRNA from Qiagen (siControl_1) and non-targeting siRNA from Dharmacon (siControl_2) were used as controls. Three independent siRNAs were used to silence JMJD1a: JMJD1a_1 custom siRNA (sense: 5′-GUCUAUGUGGGAAUUCCCA-3′, antisense: 5′-UGGGAAUUCCCACAUAGAC-3′) was ordered based on previous publication27 (link) from Sigma. Dharmacon JMJD1a siRNA (JMJD1a_2) was used to validate the results. Third siRNA (siJMJD1a_3; sense 5′-GCAAUUGGCUUGUGGUUACUU-3′ and antisense 5′-GUAACCACAAGCCAAUUGCUU-3′) was ordered based on previous publication57 (link) from Sigma. eGFP-JMJD1a (EX-T3698-M29) constructs were ordered from GeneCopoeia. pQCXIH-Myc-YAP (Addgene plasmid #33091) and pQCXIH-Myc-YAP-5SA (ref. 44 (link); Addgene plasmid #33093) were gifts from Kunliang Guan and constitutively active Src pLNCX chick src Y527F (Addgene plasmid # 13660) was a gift from Joan Brugge.

Complementary guide oligo nucleotides were annealed and ligated into a linearised pSpCas9(BB)-2A-Puro (PX450 V2) plasmid, Addgene (#48139) at the Bbsl restriction site, to generate the YAP KO construct. Guide RNA sequences targeting YAP were designed previously in Hansen et al (2015b) (link) (forward primer; CACCGCATCAGATCGTGCACGTCCG and reverse primer; AAACCGGACGTGCACGATCTGATGC). Cells were transfected using Lipofectamine LTX transfection reagent (Invitrogen) following the manufacturer’s protocol. Selection for the population of interest was performed for 48 h using puromycin (1 µg/ml) (AlfaAesar). Single-cell sorting was performed in 96-well plates containing RPMI supplemented with 20% FBS using the BD FACS Aria II (with the assistance of the QMRI flow cytometry team). Colonies were expanded and replicate plates were obtained, which were screened for positive KOs via Western blots. Whole uncut membranes of Western blots were used to ensure that no truncated versions of the proteins were observed. In addition, second validation Western blots using additional antibodies recognising distinct parts of the target proteins were performed (not shown). In addition, YAP rescue cells were generated, whereby YAP KO clones were transduced with pQCXIH-empty as a vector control or reexpressing myc-tagged WT-YAP pQCXIH-Myc YAP plasmid, Addgene (#33091).