Mirna first strand cdna synthesis kit

Ten miRNAs were selected for qRT-PCR to verify the differential expression results of sequencing. For miRNA expression, a miRNA first-strand cDNA synthesis kit (Accurate Biology, Hunan, China) was used to perform real-time fluorescent quantitative PCR. U6 snRNA was used as an internal reference. All qRT-PCR reactions were performed in the ABI 7500 real-time PCR system (Applied Biosystems, California, USA), with three reactions/samples. The relative expression of miRNA was calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)).

Total RNA extraction was carried out with Trizol (AG, 21101) following the manufacturer’s protocols. The Reverse Transcriptase M-MLV (AG, 11705) was then used to convert the extracted total RNA into cDNA. Primer sequences of RUNX2 were: forward: 5′ CTCACTACCACACCTACCTG 3′ and reverse: 5′ TCAATATGGTCGCCAAACAGATTC 3′. Primer sequences of ALP were: forward: 5′ CCACGTCTTCACATTTGGTG 3′ and reverse: 5′-AGACTGCGCCTGGTAGTTGT-3′. The miRNA first-strand cDNA synthesis kit (Accurate Biotechnology, Hunan) was performed to reverse-transcribe miRNA. The miR-181a-5p-specific forward primer was AACATTCAACGCTGTCGGTGAGT, and U6 served as a standardization control. Quantitative reverse transcriptase PCR was carried out, and the relative standard curve method was performed to assess the results of the PCR data analysis.

TruSeq Stranded Total RNA with Ribo-Zero Gold (Illumina, United States); AgencourtAMPure XP (BECKMAN COULTER, United States); Agencourt RNAClean XP(BECKMAN COULTER, United States); QubitRNA Assay Kit (Life Technologies, United States); QubitdsDNA Assay Kit (Life Technologies, United States); Bioanalyzer 2100 RNA-6000 Nano Kit (Aglient, United States); Bioanalyzer 2100 DNA-1000 Kit (Agilent, United States); SuperScript II Reverse Transcriptase (Invitrogen, United States); miRNA first strand cDNA synthesis kit (Accurate Biology, China); TRIpure Reagent Total RNA Extraction Reagent (Bioteke Corporation, China); primer (Tsingke Biotechnology Co., China).

The femurs were collected from wild-type, Mir155-Tg, and Mir155-KO mice. And bones were ground with a high-speed low-temperature tissue homogenizer (Servicebio, China). As previously reported (Teng et al., 2022 (link)), the miRNAs were extracted from BMSCs and ground bone tissues with the MolPure Cell/Tissue miRNA Kit (Yeasen, China) as per the manufacturer’s instructions. The miRNA was further reversed by Tailing reaction using miRNA first strand cDNA synthesis kit (Accurate Biology, China). In brief, 3.75 μL miRNA, 5 μL 2×miRNA RT Reaction Solution, 1.25 μL miRNA RT Enzyme Mix were incubated at 37°C for 1 hr, 85°C for 5 min. The mRNAs from osteoclasts induced from Mir155-KO and wild-type mice were extracted with an RNA extraction kit (Accurate Biology, China) as per the manufacturer’s instruction. Total RNA (500 ng) was transcribed with reversed regents (Accurate Biology, China). RT-qPCR was performed using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, China) on an AriaMx Real-time quantitative PCR machine (Agilent, USA). The PCR conditions were 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. The fold change relative to the control group was measured by the 2^-∆∆Ct method. The primers used were shown in Table 1.