Log In Sign up
The largest database of trusted experimental protocols

Gecko v2 library

Manufactured by Addgene
Visit Supplier
Sourced in United States

The GeCKO v2 library is a genome-scale CRISPR-Cas9 knockout library designed for loss-of-function genetic screens in human and mouse cells. The library contains a collection of single guide RNAs (sgRNAs) targeting the majority of human and mouse genes. It is a tool for identifying genes involved in various biological processes and pathways.

Automatically generated - may contain errors

Lab products found in correlation

Lenticrispr v2, by Addgene (1 mentions) Hek293 cell, by American Type Culture Collection (1 mentions) Pspax2, by Addgene (1 mentions) Pmd2 g, by Addgene (1 mentions) Pspcas9 bb 2a gfp px458, by Addgene (1 mentions)

Spelling variants of this product

GeCKO v2 (5 citations) GeCKO v2 sgRNA library (4 citations) Human GeCKO v2 Library (3 citations) GeCKO library (2 citations) Human CRISPR Knockout Pooled Library (GeCKO V2, (2 citations)

4 protocols using gecko v2 library

1

Obtaining Cell Lines and Plasmids for CRISPR Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Materials were obtained from the following sources: WT HAP1 cells were from Horizon Discovery (Cambridge, United Kingdom); HEK293 cells were from ATCC (Manassas, VA, USA); and HEK293FT and RPE-1 cells were kindly provided by Michael Cole (Geisel School of Medicine at Dartmouth, Hanover, NH, USA) and Christopher Shoemaker (Geisel School of Medicine at Dartmouth, Hanover, NH, USA), respectively. A human GeCKO v2 library (1 plasmid system), lentiCRISPRv2, pMD2.G, and psPAX2 were obtained from Addgene (Cambridge, MA, USA).
Chidawanyika T., Mark K.M, & Supattapone S. (2020). A Genome-Wide CRISPR/Cas9 Screen Reveals that Riboflavin Regulates Hydrogen Peroxide Entry into HAP1 Cells. mBio, 11(4), e01704-20.
+ Open protocol
+ Expand
2

CRISPR-Mediated Knockout of ATG4B

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single-guide RNA (sgRNA) sequences targeting ATG4B were selected from the GeCKO V2 library (Addgene) (ATG4B-1: TCCTGTCGATGAATGCGTTG) and ligated into pSpCas9(BB)-2A-GFP (PX458) (Addgene). JIMT-1 cells were transfected with the resultant CRISPR plasmid. Monoclonal cell lines were established by FACS sorting GFP-positive cells into single-cell culture 48 hours after transfection and verified with western blotting.
Bosc D., Vezenkov L., Bortnik S., An J., Xu J., Choutka C., Hannigan A.M., Kovacic S., Loo S., Clark P.G., Chen G., Guay-Ross R.N., Yang K., Dragowska W.H., Zhang F., Go N.E., Leung A., Honson N.S., Pfeifer T.A., Gleave M., Bally M., Jones S.J., Gorski S.M, & Young R.N. (2018). A new quinoline-based chemical probe inhibits the autophagy-related cysteine protease ATG4B. Scientific Reports, 8, 11653.
+ Open protocol
+ Expand
3

Expanded GeCKO V2 CRISPR Library Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GeCKO V2 library (Addgene #100000049)(28 (link)) was expanded by transforming the library into DH10B cells by electrophoresis with a total of 2.5X107 clones produced. A sgRNA library for the second round screening was created by cloning sgRNAs synthesized by IDT technology (Coralville, Iowa USA 52241) individually, mixed manually and finally cloned into the vector pCDHgfpCr. All other individual sgRNAs were cloned either into the plasmid pCDHpuroCr or pCDHgfpCr. sgRNA sequences used for targeting PSMC1 to 6 are displayed in supplemental 1.
Shi C.X., Kortüm K.M., Zhu Y.X., Bruins L.A., Jedlowski P., Votruba P.G., Luo M., Stewart R.A., Ahmann J., Braggio E, & Stewart A.K. (2017). CRISPR genome-wide screening identifies dependence on the proteasome subunit PSMC6 for Bortezomib sensitivity in multiple myeloma. Molecular cancer therapeutics, 16(12), 2862-2870.
+ Open protocol
+ Expand
4

Genome-wide CRISPR Screen for Centrinone Resistance

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CRISPR/Cas9 screen was performed using the human GeCKO v2 library (#1000000048; Addgene; Sanjana et al., 2014 (link)). 3.2 million RPE-1 cells were infected with 12.8 million infectious virus particles in a 15-cm plate using 20 ml DMEM/F12 medium and 8 µg/ml polybrene. Cells were treated with 150 nM centrinone. After 2 d, cells were transferred to 32 15-cm plates (first screen) or 75 15-cm plates (second screen). Centrinone treatment was continued for 3 wk. After 3 wk, growing colonies were isolated. Isolated clones were further analyzed in a secondary Mdm2i screen (first and second screen) as well as pooled and analyzed by Illumina sequencing (first screen).
Meitinger F., Anzola J.V., Kaulich M., Richardson A., Stender J.D., Benner C., Glass C.K., Dowdy S.F., Desai A., Shiau A.K, & Oegema K. (2016). 53BP1 and USP28 mediate p53 activation and G1 arrest after centrosome loss or extended mitotic duration. The Journal of Cell Biology, 214(2), 155-166.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!