DNA was extracted from peripheral blood leucocytes by a standardized salting-out procedure.25 (link) Genotyping of the Val66Met polymorphism (rs6265) of the BDNF gene was determined using the forward (GGCTTGACATCATTGGCTGAC) and reverse (GGTCCTCATCCAACAGCTCTT) primers and probes in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA). One allele probe was labeled with VIC dye and the other was labeled with FAM dye. The reactions were conducted in a 96-well plate with a total reaction volume of 20 µl, using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems), and a custom TaqMan genotyping assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).
Taqman genotyping master mix 1x
Manufactured by Thermo Fisher Scientific
Sourced in United States
TaqMan Genotyping Master Mix 1x is a ready-to-use reaction mixture for real-time PCR-based genotyping assays. It contains all the necessary components, including DNA polymerase, dNTPs, and buffer, to perform genotyping analysis.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real pcr system, by Thermo Fisher Scientific (2 mentions)
Human custom taqman genotyping assay 40x, by Thermo Fisher Scientific (2 mentions)
Sds 2, by Thermo Fisher Scientific (2 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Taqman system, by Thermo Fisher Scientific (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
5 protocols using taqman genotyping master mix 1x
1
BDNF Genotyping by TaqMan Assay
2
DIO2 Gene Genotyping in Peripheral Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from peripheral blood leukocytes by a standardized procedure. Primers and probes contained in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA) were used for genotyping our samples. The predesigned TaqMan SNP Genotyping Assay® C_15819951_10 was used to analyze the DIO2 gene (rs225014 [Thr92Ala]) SNP (Applied Biosystems, Foster City, CA, USA). One allelic probe was labeled with VIC dye and the other with FAM dye. The reactions were conducted in a 96-well plate with a total 5 µL reaction volume using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems, Waltham, MA, USA), and Custom TaqMan Genotyping Assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 50 cycles of 95 °C for 15 s and 60 °C for 90 s. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).
Patients were classified as Ala/Ala, Thr/Ala, or Thr/Thr genotypes. All amplification reactions were performed twice. The genotyping success was over 95%, with a calculated error rate based on PCR duplicates of 0%.
Patients were classified as Ala/Ala, Thr/Ala, or Thr/Thr genotypes. All amplification reactions were performed twice. The genotyping success was over 95%, with a calculated error rate based on PCR duplicates of 0%.
3
Genotyping HTR2A -1438A/G SNP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
With the objective of analyzing the single nucleotide polymorphism (SNP) serotonin receptor HTR2A -1438A/G (rs6311) the technique of amplification of fragments of DNA by polymerase chain reaction was used in real time using the TaqMan® system (Applied Biosystems, Foster City, USA). The reaction consisted of a final volume of 10 μL being: 5.25 μl of Taqman® Genotyping Master Mix (1x), 0,5 μL of probe (1x) (Applied Biosystems, Foster City, USA), 3,25 μL of ultrapure water Milli-Q® and 1 μL of DNA (30 ng/uL).
Real-time thermal cycler Rotor-Gene Q® (Qiagen, Germany) was used with the cycling of 60 °C for 30 s (initial denaturation), 95 °C for 10 min for initial denaturation, 50 cycles of 95 °C for 15 s (denaturation) and 60 °C for 1 min and 30 s (pairing of initiators and extension) and a final cycle of extension of 30 s at 60 °C.
For the SNP allele discrimination, the Software Gene Rotor Q -Pure Detection version 2.0.3 (Qiagen, Germany) was used.
Real-time thermal cycler Rotor-Gene Q® (Qiagen, Germany) was used with the cycling of 60 °C for 30 s (initial denaturation), 95 °C for 10 min for initial denaturation, 50 cycles of 95 °C for 15 s (denaturation) and 60 °C for 1 min and 30 s (pairing of initiators and extension) and a final cycle of extension of 30 s at 60 °C.
For the SNP allele discrimination, the Software Gene Rotor Q -Pure Detection version 2.0.3 (Qiagen, Germany) was used.
4
TGFB1 Gene Variant Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from peripheral blood samples using a standardized technique. TGFB1 rs1800469 (c.-1347 C>T; C-509T) and rs1800470 (c.+29 T>C; T869C; Leu10Pro) SNPs were genotyped using TaqMan SNP Genotyping Assays 20X (Thermo Fisher Scientific, Foster City, CA, USA; Assay ID: C_8708473_10 and C_22272997_10, respectively). Real-Time PCR reactions were performed in 384-well plates, in a total 5 µL volume, using 2 ng of DNA, TaqMan Genotyping Master Mix 1X (Thermo Fisher Scientific) and TaqMan Genotyping Assay 1X. PCR reactions were performed in a real-time PCR thermal cycler (ViiA7 Real-Time PCR System; Thermo Fisher Scientific).
5
ENPP1 K121Q Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood samples were collected from all patients for DNA extraction and genotyping of the ENPP1 K121Q polymorphism. DNA was extracted using a standardized salting-out procedure. Genotyping of the K121Q (A/C) polymorphism (rs1044498) in exon 4 of the ENPP1 gene was performed using primers and probes contained in the Human Custom TaqMan Genotyping Assay 20x (Thermo Fisher Scientific Inc., Waltham, MA, USA). Primer and probe sequences used for genotyping were: 5-AGCCTCTGTGCCTGTTCAG-3’ (forward primer), 5’-ACACACAGAACTGTAGTTGATGCA-3’ (reverse primer), 5’-AGTCGCCCTTGTCCTT-3’ (VIC probe), and 5’-TCGCCCTGGTCCTT-3’ (FAM probe). All reactions were conducted in 96-well plates, in a total of 5 μl volume using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Thermo Fisher Scientific Inc.) and Custom TaqMan Genotyping Assay 1x, and ran on the 7500 Fast Real-Time PCR System (Thermo Fisher Scientific Inc.).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!