The following materials were obtained from the sources indicated: ATP (disodium salt hydrate), MgSO4, and Triton X-100 from Sigma-Aldrich (St. Louis, MO); dithiothreitol (DTT) from Acros; beetle luciferin (LH2), Bright-Glo™ Luciferase Assay system, Passive Lysis Buffer (PLB), and pF4Ag containing the luc2 gene (non-commercial expression vector driven by a CMV promoter) were from Promega (Madison, WI). A human codon optimized version of the PLG2 gene2 was constructed by modifying the portion corresponding to the N-terminus as previously described [39 (link)] and synthesis of the C-domain by GenScript according to the OptimumGene™ algorithm. The codon optimized PLG2 gene was prepared by ligation of the 2 optimized domains and cloned into the Sgf1/Pme1sites of the Promega pF4Ag vector.
Optimumgene
Manufactured by GenScript
Sourced in United States
OptimumGene is a laboratory equipment product designed for gene optimization. It enables the efficient modification and optimization of gene sequences to enhance desired characteristics. The core function of OptimumGene is to facilitate the genetic engineering process through advanced tools and algorithms, without making claims about its intended use.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Passive lysis buffer (plb), by Promega (1 mentions)
Dithiothreitol (dtt), by Thermo Fisher Scientific (1 mentions)
Triton x 100, by Merck Group (1 mentions)
Mgso4, by Merck Group (1 mentions)
Bright glo luciferase assay system, by Promega (1 mentions)
Pvax1, by Thermo Fisher Scientific (1 mentions)
7 protocols using optimumgene
1
Optimized Luciferase Reporter Assay
2
Codon-optimized C. violaceum CV2025 Expression in K. phaffii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The C. violaceum CV2025 gene was codon-optimised for expression in K. phaffii using the OptimumGene™ algorithm by GenScript. The optimised coding sequence is available as a public data set (Braun-Galleani et al., 2018 ). The 1.4 kb CV2025 gene was flanked by BsaI sites enabling subcloning into a lone BsaI site present in pJ902-15 to generate the new, 4.9 kb plasmid, pJ-CV2025. BG-10 cells were transformed using 20 μg of SacI-linearised pJ-CV2025 by electroporation (1500 V, 200 Ω, 25 μF) and subsequently plated onto YPD agar plates supplemented with 1 M sorbitol and 200–1000 μg mL−1 of zeocin to select for stable integrants.
Colony PCR was used to confirm the presence of integrated pJ-CV2025 in the AOX1 locus in zeocin-resistant colonies using the primer, CCAAAGACGAAAGGTTGAATG, which was designed to anneal within the AOX1 promoter and the primer, GATAATTCGACAACAGCAGG, designed to anneal within the codon-optimised C. violaceum CV2025 gene at a position predicted to be 300 base pairs downstream of the AOX1 promoter only in transformants. Transformant colonies, which were both zeocin resistant and positive by colony PCR, were designated ‘BG-TAM’ and a master cell bank of clones was generated and cryopreserved at -80 °C.
Colony PCR was used to confirm the presence of integrated pJ-CV2025 in the AOX1 locus in zeocin-resistant colonies using the primer, CCAAAGACGAAAGGTTGAATG, which was designed to anneal within the AOX1 promoter and the primer, GATAATTCGACAACAGCAGG, designed to anneal within the codon-optimised C. violaceum CV2025 gene at a position predicted to be 300 base pairs downstream of the AOX1 promoter only in transformants. Transformant colonies, which were both zeocin resistant and positive by colony PCR, were designated ‘BG-TAM’ and a master cell bank of clones was generated and cryopreserved at -80 °C.
3
Codon-optimized scr96 expression in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To facilitate the expression of scr96 (GenBank no. KT215393) in P. pastoris cells, the gene codon, excluding its signal peptide, was optimized using the OptimumGene algorithm (GenScript, Nanjing, Jiangsu Province, China). The codon-optimized gene fragment (Figure S8 ) was synthesized by GenScript and cloned into a modified pPink-HC (Thermo Fisher Scientific, Waltham, MA, USA) containing a Saccharomyces cerevisiae α-mating factor secretion signal and C-terminal His9 tag using NcoI and KpnI restriction sites. The resultant plasmid was verified by endonuclease digestion and DNA sequencing.
4
SARS-CoV-2 Spike Protein Pseudotyped Virus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The VSVΔG-GFP/G virus was recovered from the VSVΔG-GFP-2.6 plasmid and helper plasmids (G, L, N, and P; Kerafast, Boston, MA) by following previously described methods (19 (link)). Human codon-optimized S cDNA encoding the WT (wild-type, MN908947.3) or variants were inserted in the pVax1 expression vector. Codon optimization is based on OptimumGene from GenScript. The BHK-21 cells were transfected with pVax1-SARS-CoV-2 S plasmid using lipofectamine 2000 (ThermoFisher, Waltham, MA) and infected with the VSVΔG-GFP/G virus (moi=5) the next day. After incubation for 24 hrs, the cultured supernatants were clarified by centrifugation at 1,320 × g for 10 min and stored at -80°C. For titration, BHK21-hACE2 cells were infected with serially-diluted Spp stock, and the virus titer (ffu/ml) was calculated by counting GFP positive cells. The S cDNA lacking C-terminal ER retention signal (SΔ19) was PCR amplified and inserted into the VSV-ΔG-GFP-2.6 vector. The replication-competent SΔ19 virus was recovered by the following method described previously (22 (link)) and briefly described in the Supplementary Methods.
5
Optimization of hCNTF Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The codons of the hCNTF gene were optimized for optimal usage in E. coli using a commercial proprietary algorithm, OptimumGene™ (GenScript, NJ, USA). Variety of parameters were optimized, including codon usage bias, GC content, CpG dinucleotides content, mRNA secondary structure, cryptic splicing sites, premature PolyA sites, internal chi sites and ribosomal binding sites, negative CpG islands, RNA instability motif, repeat sequences. The synthetic gene was purchased from GenScript, US.
6
Multicistronic Plasmid Constructions for Gene Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on a clinically approved plasmid vector pVax1 (Thermo Fisher Scientific) [62 (link)], multicistronic constructions encoding various gene combinations (pVax1-VEGF-FGF2-DsRed, pVax1-VEGF-DsRed, pVax1-FGF2-DsRed, pVax1-DsRed) were designed and developed (Figure 1 ). Nucleotide sequences of the VEGF (GeneBank AF486837.1) and FGF2 (GeneBank #DD406196.1) genes were obtained from the NCBI database and cloned under a single CMV promoter. The Fu-cleavage site (AGAAACAGAAGA) and p2A skipping motif (CCACGAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT) were incorporated between the target genes [63 (link)]. To enhance gene expression and reduce restriction sites, an Optimum Gene™ (GenScript, Piscataway, NJ, USA) algorithm was applied. Synthesis of plasmid constructions de novo were carried out using GenScript (https://www.genscript.com/ ).
7
Codon-Optimized aceP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The aceP gene was chemically synthesized with an optimal codon usage for expression in E. coli, under the control of lac promoter. The synthetic aceP gene was codon optimized by the OptimumGene software tool (GenScript, Piscataway, NJ, USA Inc.). The synthetic version of aceP flanked by KpnI andNdeI restriction sites was cloned in the puc18 vector, originating the pAceP vector.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!