Transcriptor high fidelity cdna kit

Total RNA was extracted by RNeasy mini kit (QIAGEN, Hilden, Germany) and treated with DNase I. A half μg of the total RNA was used for cDNA synthesis by Transcriptor High Fidelity cDNA kit (Roche, Basel, Switzerland). Quantitative RT-PCR was performed by FastStart Universal SYBR Green Master (Roche, Basel, Switzerland) by StepOnePlus realtime PCR system (Applied Biosystems, Foster City, CA, USA). The sequences of the used primers are shown in Table S3.

RNA was isolated from the tissue samples using the SV Total RNA isolation kit (Promega) or TRIzol reagent (Invitrogen), and contaminating DNA was removed using DNase I (Thermo Scientific) according to the manufacturer's protocol. The M‐MuLV Reverse Transcriptase (Thermo Scientific) or Transcriptor High Fidelity cDNA kit (Roche) was used to reverse‐transcribe RNA into cDNA using random hexameric primers. Quantitative real‐time (RT)‐PCR was performed in triplicate using GoTaq polymerase (Promega) or SensiMix SYBR Low‐Rox One Step kit for analysis in Stratagene Mx3005P cycler. Mouse TAZ (Acehan et al, 2011) and mouse SDHA (5'‐ACACAGACCTGGTGGAGACC‐3′; 5'‐GGATGGGCTTGGAGTAATCA‐3′) mRNA levels were compared to β‐actin (5′‐TGTTACCAACTGGGACGACA‐3′; 5′‐GGGGTGTTGAAGGTCTCAAA‐3′). Mouse Cox1 (5'‐ATCCCTTGACATCGTGCTTC‐3′; 5'‐AAGTGGGCTTTTGCTCATGT‐3′) and Atp66 (5'‐CCTTCCACAAGGAACTCCAA‐3′; 5'‐GGTAGCTGTTGGTGGGCTAA‐3′) mRNA levels were compared to 16S rRNA (5'‐CCAATTAAGAAAGCGTTCAAG‐3′; 5'‐CCATCCAATCGGTAGTAGCG‐3′). Human SDHA (5'‐ACACGGACCTGGTGGAGACC‐3′; 5'‐GGATGGGCTTGGAGTAATCG‐3′) gene expression was compared to L28 (5'‐GCAATTCCTTCCGCTACAAC‐3′; 5'‐TGTTCTTGCGGATCATGTGT‐3′). Further primer sequences are available upon request.