The largest database of trusted experimental protocols

Geneticin

Manufactured by MP Biomedicals
Sourced in United States

Geneticin is a broad-spectrum antibiotic used for the selection and maintenance of mammalian cell lines expressing recombinant genes. It functions by inhibiting protein synthesis in eukaryotic cells.

Automatically generated - may contain errors

6 protocols using geneticin

1

GIL1 gene expression construct generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate the PGIL1-GIL1-GFP fusion construct, the GIL1 gene with its 1.5-Kb upstream promoter sequence were amplified with primer GIL1/F and GIL1/R (Table S1) and cloned into pFL2 [47 (link)] by the yeast in vivo homologous recombination approach [48 (link)]. The PRP27-GIL1-GFP construct was generated with a similar approach by cloning the PCR product amplified with primers GIL1F/RP27 and GIL1R/RP27 (Table S1) into pFL2. The resulting GIL1-GFP construct was transformed into protoplasts of the wild type PH-1. Geneticin (MP Biochemicals, Santa Ana, CA, USA)-resistant transformants harboring the transforming GFP fusion constructs were identified by PCR and examined for GFP signals using a confocal microscopy with Nikon Tie system (Nikon, Japan).
+ Open protocol
+ Expand
2

MACF1 Overexpression and Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
MACF1 overexpression cells were constructed by transfection of plasmid PEGFP‐C1A‐ACF7 as previously described,21 (link) with PEGFP‐C1–transfected cells as control. MC3T3‐E1 cells (1 × 107 per well) or primary BMSCs (5 × 106 per well) were electroplated (1800V, 30ms) with the MACF1 overexpression plasmid PEGFP‐C1A‐ACF7 or normal plasmid PEGFP‐C1A by using Neon Transfection System (Invitrogen) according to manufacturer's instructions. After the electroporation, cells were seeded into a 6‐well plate with 10ml α‐MEM and cultured for 6h. Adherent cells were then washed by 2ml α‐MEM two times, and medium was changed to antibiotic‐free culture medium. After culture for 48 hours, medium was changed to the selective growth medium supplemented with 650 μg/mL geneticin (MP Biomedicals, 0215878291) and cells were cultured for two weeks. Screened cells were used as MACF1 overexpression MC3T3‐E1 cells and BMSCs.
Stable MACF1 knockdown MC3T3‐E1 cell line was made by transfection of lentivirus vector carrying shRNA targeting murine MACF1 (NM_001199136.1) or its scramble control as described previously.23 (link)
+ Open protocol
+ Expand
3

Construction of MACF1 Overexpressed and Knockdown Preosteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
MACF1 overexpressed preosteoblast was constructed as described previously (Yin et al., 2018 (link)). Briefly, MC3T3-E1 cells (1×107 per well) were electroplated (1800V and 30 ms) with the MACF1 overexpression plasmid pEGFP-C1A-ACF7 or control plasmid pEGFP-C1A using Neon Transfection System (Invitrogen) following the manufacturer's instructions. After the electroporation, cells were seeded into a six-well plate with 10 ml α-MEM and cultured for 6 h. Adherent cells were then washed with 2 ml α-MEM twice and the medium was changed to antibiotic-free growth medium (α-MEM with 10% FBS, and 1% L-glutamine). After being cultured for 48 h, the medium was changed to selective growth medium supplemented with 650 μg/ml Geneticin (MP Biomedicals, Santa Ana, CA, USA) and cells were continuously cultured for 2 weeks. MACF1 overexpression preosteoblast was monoclonalized by limited dilution method.
Stable MACF1-knockdown MC3T3-E1 cell line was established by transfection of lentivirus vector carrying shRNA targeting murine MACF1 (NM_001199136.1) or its scramble control as described previously (Hu et al., 2015 (link), 2018 (link)).
+ Open protocol
+ Expand
4

Propagation and Selection of Fission Yeast

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli strain DH5α was used to propagate plasmids in standard LB medium. The S. pombe leu1.32 his2 h+(IH147) and 972h- (IH5974) strains were grown by standard procedures [2] (link). The following stock solutions of 100 mg ml−1 Geneticin (MP Biomedicals, 158782), Hygromycin B (Calbiochem, 400050), Nourseothricin/ClonNat (Werner BioAgents, 96736-11-7), Phleomycin (Sigma, P9564), and Cyclohexamide (Sigma, C1988) were added to generate final concentrations of 100 µg/ml in the growth medium where appropriate.
+ Open protocol
+ Expand
5

Construction of Stable SILAC Strain

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 100 bp primer pair (NIC1_FORW, AAAATTGTTATTATTATTGGAATCCTAAGTGGATACAGGTTTATGTGAACGCAATCTATTCAAATTACGCGTTTATTTGTTTAATTAAGGCGCGCCAGAT; NIC1_REV, ACGACTGGGAATTTCTGTTTCCTTTTTTTTTCTTCAGTATTCTCGATTTGTTCTCTTAACCTGTTGCTTGGGTTAAAAGTGTTTAAACTGGATGGCGGCG) were designed such that the first 80 nucleotides were homologous to the sequences flanking the nic1+ gene and the last 20 nucleotides were homologous to the pYM14 template plasmid with the natMX6 marker (pFA6natMX6) (5 (link), 16 (link)). The PCR product was transformed into the strain IH6113 (pku80::ura4+ura4.d18 leu1.32). Emergent colonies that were resistant to Geneticin (MP Biomedicals, 158782) were selected. After PCR analysis confirmed the desired integration event, two rounds of back-crossing to wt preceded crossing into the SILAC base strain generated the SILACn base strain (h- nic1::KanMX6 car2::NatMX6 lys1.131 arg3.D4; IH 11849).
+ Open protocol
+ Expand
6

Neuroblastoma and Fibroblast Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used human SH-SY5Y neuroblastoma cells (CRL-2266, ATCC) stably expressing empty pcDNA3.1 vector (Control), or the human βAPP harboring the double Swedish mutations cDNA (APPswe: APPKM670/671NL) [29 (link)]. We also used mouse embryonic fibroblasts: MEFs either control (MEF APPWT or MEF PSWT), invalidated for APP and for APP-like proteins 1 and 2 (APLP1 and APLP2) (MEF APPKO) [30 (link)], or doubly knocked out for presenilin 1 (PS1) and presenilin 2 (PS2) (PSDKO) [31 (link)]. Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO 41965-039) supplemented with 10% Fetal Bovine Serum (FBS), penicillin (100 U/ml) and streptomycin (50 μg/ml) (Pen/Strep), and incubated at 37 °C in 5% CO2 atmosphere. Control and APPswe SHSY5Y cells were cultured in the presence of 400 μg/ml geneticin (MP Biomedicals) [29 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!