The largest database of trusted experimental protocols

Recombinant nfκb p65 protein

Manufactured by Active Motif
Sourced in Japan

Recombinant NFκB p65 protein is a purified protein produced in a recombinant expression system. It is the p65 subunit of the NF-κB transcription factor complex, which plays a central role in regulating the immune response and inflammation.

Automatically generated - may contain errors

3 protocols using recombinant nfκb p65 protein

1

NFκB p65 Binding Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant NFκB p65 protein (Active Motif; 31102)(500 ng) was incubated with 40 ng of oligonucleotide probes for NFκB p65 containing either a consensus (5′-CGACATGATACACTA AGAAATTC TATTCTGCAGACACTGC-3′) or a mutated (5′-CGAC ATGATACACTAAGAAAAAATATTCTGCAGACACTG C-3′) sequence, similar to the NFκB sequence found in the MUC16 promoter by bioinformatics analysis and used in the luciferase assay, in a reaction mixture following the manufacturers instructions containing 2 μl of EMSA/Gel-shift binding buffer 5× from EMSA Kit (ThermoFisher; E33075) containing 750 mM KCl, 0.5 mM dithiothreitol, 0.5 mM EDTA, 50 mM Tris, pH 7.4 for 40 min. The reaction mixtures were separated by 12% non-denaturing PAGE. The gel was then stained for 20 min with 1× SYBR® green staining solution; the gel was then washed with dH20 two times for ∼2 sec followed by visualization using a Carestream Imaging system.
+ Open protocol
+ Expand
2

Quercetin and Carboxymethyl Cellulose Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quercetin (QUR) (Cat# Q4951) and Carboxymethyl Cellulose (CMC) (Cat# C5678-500G) were purchased from Sigma Aldrich (St. Louis, MO, USA). Colorimetric and ELISA kits to measure levels of Troponin-I (Cat# E4737), creatinine kinase-MB (CKMB) (Cat# E4608), interleukin-6 (Cat# K4145), superoxide dismutase (SOD) (Cat# E458), tumor necrosis factor-α (TNF-α) (Cat# K1052), reduced glutathione (GSH) (Cat. NO. K454), and malondialdehyde (MDA) (Cat# K454) were purchased from BioVision, CA, USA. ROS assay kit (Cat# E-BC-K138-F) was purchased from Elabscience, CA, USA. A recombinant NF-κB p65 protein (Cat# 31102) and ELISA kit to measure the nuclear activity of NF-κB p65 (Cat# 40096) were purchased from Active Motif, Tokyo, Japan. An ELISA kit to measure serum and tissue levels of ANG II (Cat# CSB-E04494r) was purchased from CUSABIO, TX, USA. ANG II cocktail inhibitor (Cat# 9000681) was purchased from Cayman Chemicals, USA.
+ Open protocol
+ Expand
3

Synthesis and Purification of Kynurenine Metabolites

Check if the same lab product or an alternative is used in the 5 most similar protocols
Probenecid was from Enzo Life Sciences, l-tryptophan-d3 and 13C3-cysteine were from Toronto Research Chemicals (Toronto, Canada); interferon-γ was from BD Pharmingen (Franklin Lakes, NJ); recombinant NF-κB–p65 protein was from Active Motif (Carlsbad, CA); 13C2,15N-GSH was from Sigma-Aldrich (St. Louis, MO); and Kyn-CKA [4-(2-aminophenyl)-4-oxobut-2-enoic acid] was custom-synthesized by Toronto Research Chemicals (ε390 nm = 3871 M−1 cm−1). 15N,13C2-GSH and 13C3-cysteine conjugates of Kyn-CKA were generated by reacting 100 equivalents of thiol with Kyn-CKA in 5 mM ammonium bicarbonate (pH 8.0) for 1 hour at 37°C, followed by solid-phase extraction using HyperSep C18 cartridges (Thermo Fisher Scientific). L-Kyn and N-formylkynurenine stocks were treated with 35 mg of 3-mercaptopropyl–functionalized silica from SiliCycle (Quebec City, Canada) for 15 min at room temperature to remove potential Kyn-CKA traces, followed by 0.22-μm filtration. Organic solvents were LC-MS grade (Thermo Fisher Scientific), and all other chemicals were of analytical grade and obtained from Sigma-Aldrich unless specified.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!