Exicycler tm 96 real time quantitative pcr system

Total RNA was extracted using the high pure total RNA rapid extraction kit (BioTeke, Beijing, China), and reverse transcribed into cDNAs using M-MLV reverse transcriptase (Takara, Beijing, China) and RNase inhibitors (Takara). Oligo (dT) 15 and RT primer were used for HMGB1 and miR-129-5p amplification during reverse transcription reactions. The RT primer was: 5'-GTTGGCTCTGGTGCAGGGTCCGAGG-TATTCGCACCAGAGCCAACGCAAGC-3' . Real-time PCR was performed with cDNA templates, primers (Genscript, Nanjing, China), SYBR GREEN (BioTeke), and Taq TM HS Perfect Mix (Takara), using the Exicycler TM 96 Real-time Quantitative PCR system (Bioneer, Daejeon, Republic of Korea). Relative expression levels were measured by the 2 -ΔΔCT method. Primer sequences were: HMGB1-F: GCCTTCTTCTT-GTTCTGTT, HMGB1-R: TTTCATAGGGCTGCTTG, β-actin-F: GGAGATTACTGCCCTGGCTCCTAGC, β-actin-R: GGCCGGACTCATCGTACTCCTGCTT, rno-miR-129-5p-F: CTTTTTGCGGTCTGGGCTTGC, rno-miR-129-5p-R: GCAGGGTCCGAGGTATTC, 5S-F: GATCTCG-GAAGCTAAGCAGG, 5S-R: TGGTGCAGGGTCCGAG-GTAT. β-actin and 5S were used as internal references for HMGB1 and miR-129-5p, respectively.

Livers of rats were taken and divided. One of the samples of livers were stored in formaldehyde for TUNEL staining, and another of the samples of livers were stored at -86°C until further analysis. Thirty mg of frozen liver tissues were homogenized in 500 µl Tissue Lizis Buffer for 1 min using homogenizer (Bioprep-24, Allsheng). Total RNA was obtained from liver samples using an ExiPrepTM Tissue Total RNA isolation kit (Bioneer, K-3325). The RNA concentration was determined from absorbance at 230-260 nm and 260/280 nm using a NanoDrop spectrophotometer (Denovix DS-11). The results were then reversely transcribed into cDNA using the AccuPower® RT PreMix (Bioneer, K-2041) according to the manufacturer's instructions.
Real-Time PCR was performed using AccuPower GreenStar qPCR PreMix according to the manufacturer's instructions (Bioneer, . The level of mRNA expression of Fas genes as detected using the ExiCyclerTM96 Real-Time Quantitative PCR system (Bioneer). The PCR reactions were performed as follows: 95°C for 5 min, followed by 45 cycles at 95°C for 15 s, and then 60°C for 25 s. The sequences primers used were: Forward, 5'-AGGTGCTA-GAGGCCCTGCTA-3'; Reverse, 5'-GTGCACAGACAC-CTTCCCAT-3' (Bioneer, S-1001) (Ji et al. 2011; (link)Fukunishi et al. 2014) (link). The levels of each gene expression were calculated by the 2 -ΔΔCt method.