The largest database of trusted experimental protocols

Total rna dna isolation kit

Manufactured by Tiangen Biotech
Sourced in China

The Total RNA/DNA isolation kit is a laboratory product designed to extract and purify total RNA and DNA from a variety of biological samples. It utilizes a simple and efficient process to isolate high-quality nucleic acids for downstream applications such as PCR, sequencing, and other molecular biology techniques.

Automatically generated - may contain errors

2 protocols using total rna dna isolation kit

1

Quantitative Analysis of mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mRNA levels of SUR1, TRPM4, Il-1, Il-10, TNFα, and GAPDH were routinely measured by quantitative real-time polymerase chain reaction (qPCR). Briefly, total RNA was isolated using a total RNA/DNA isolation kit (Tiangen, Peking, China) and reverse transcribed to cDNA with PrimeScriptTM RT Master Mix Kit (TAKARA) according to the manufacturer's instructions. qPCR was performed using the SYBR Green master mixes (TAKARA) and Roche LightCycler480 System. Relative changes of mRNA expression were normalized to the level of GAPDH.
The Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5′-3’: CATCCGGGTGAGGAGATACG;
Reverse primer 5′-3’: CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5′-3’: TGATGAGCACACCACGGAGA;
Reverse primer 5′-3’: ATCCGTGCGATCAGACAGC.
Il-1: Forward primer 5′-3’: CCTACTTCAGCATCCTCTACTGG;
Reverse primer 5′-3’: AGGGTTTCTTGAGAAGGGGAC.
Il-10:Forward primer 5′-3’: CCCATTCCTCGTCACGATCTC;
Reverse primer 5′-3’: TCAGACTGGTTTGGGATAGGTTT.
Tnfa: Forward primer 5′-3’: CACTCTGGGTACGTGGGTG;
Reverse primer 5′-3’: CACAGGTGATAATGAGGACAGC.
Ccnd1: Forward primer 5′-3’:GCGTACCCTGACACCAATCTC;
Reverse primer 5′-3’: CTCCTCTTCGCACTTCTGCTC.
Nlrp3: Forward primer 5′-3’: ATTACCCGCCCGAGAAAGG;
Reverse primer 5′-3’: TCGCAGCAAAGATCCACACAG.
Gapdh: Forward primer 5′-3’: AGGTCGGTGTGAACGGATTTG;
Reverse primer 5′-3’: TGTAGACCATGTAGTTGAGGTCA.
+ Open protocol
+ Expand
2

Quantitative Analysis of mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mRNA levels of SUR1, TRPM4, TGFα, and GADPH were routinely measured by quantitative real-time polymerase chain reaction (q-PCR). Brie y, total RNA was isolated using a Total RNA/DNA isolation kit (Tiangen, Peking, China) and reverse transcribed to cDNA with PrimeScriptTM RT Master Mix Kit (TAKARA) according to the manufacturer's instructions. q-PCR was performed using the SYBR Green master mixes (TAKARA) and Roche LightCycler480 System. Relative changes of mRNA expression were normalized to the level of GADPH.
Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5'-3': CATCCGGGTGAGGAGATACG;
Reverse primer 5'-3': CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5'-3': TGATGAGCACACCACGGAGA;
Reverse primer 5'-3': ATCCGTGCGATCAGACAGC.
Tgfα: Forward primer 5'-3': CACTCTGGGTACGTGGGTG;
Reverse primer 5'-3': CACAGGTGATAATGAGGACAGC.
Gapdh: Forward primer 5'-3': AGGTCGGTGTGAACGGATTTG;
Reverse primer 5'-3': TGTAGACCATGTAGTTGAGGTCA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!