Direct zol rna miniprep plus kit

Manufactured by Zymo Research

Sourced in United States, Germany

The Direct-zol RNA MiniPrep Plus kit is a laboratory product designed for the purification of total RNA from various biological samples. It utilizes a rapid spin-column procedure to extract and purify high-quality RNA efficiently.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Direct-zol RNA MiniPrep (611 citations) Direct-zol RNA kit (431 citations) Direct-zol kit (159 citations) Direct-zol RNA MiniPrep Plus (149 citations) RNA miniprep kit (63 citations) Direct-zol (62 citations) Direct-zolTM RNA MiniPrep (41 citations) MiniPrep kit (30 citations) Direct-zol MiniPrep (14 citations) Direct-zolTM RNA MiniPrep Plus (9 citations)

371 protocols using direct zol rna miniprep plus kit

Maize Drought Stress Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Maize inbred lines B73, B104, A188, and HiIIA were grown in PRO-MIX^®BRK MYCORRHIZAE^™ (Hummert International, St. Louis, MO, USA) at 27 °C/22 °C (day/night) in the greenhouse. At V5 growth stage, the seedlings were assigned to the drought treatments with three biological replicates. Plants were imposed with drought stress by withholding water. Leaf samples were collected from each plant on day 0, 2, 4, 6, and 8, and immediately frozen in liquid nitrogen and stored in −80°C freezer for further analysis.
Total RNA was isolated from leaf tissues of inbred maize lines using the Direct-zol RNA Miniprep Plus Kits (Zymo Research, Irvine, CA, USA). One µg total RNA was used to synthesize first strand cDNA using Revert Aid First Strand cDNA synthesis kit (Thermo Scientific^™, Waltham, MA, USA). Each 20 µL qRT-PCR reaction consisted of 9.4 μL diluted cDNA solution (2 ng/μL), 0.3 μL of each primer (20 μM), and 10 μL iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Primers 5′-CCGTCATCGCCTCACGAAGAG-3′ and 5′-AGAGCCTGCCTTACGGAATTGG-3′, which are based on the cyclin-dependent kinase gene CDK, were used as an expression control.

Tamang T.M., Sprague S.A., Kakeshpour T., Liu S., White F.F, & Park S. (2021). Ectopic Expression of a Heterologous Glutaredoxin Enhances Drought Tolerance and Grain Yield in Field Grown Maize. International Journal of Molecular Sciences, 22(10), 5331.

+ Open protocol

+ Expand

Total RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Direct-zol RNA Miniprep Plus Kits (Zymo Research) according to the manufacturer’s instructions. RNA concentration was quantified using a nanodrop. qRT-PCR was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). For miR-34a-5p expression assay, qPCR data were normalized to U6. For miR-34a target genes, qPCR data were normalized to GAPDH. Data were then analyzed using the 2−ΔΔCt method and expressed as fold change.

Li W.(., Wang Y., Liu X., Wu S., Wang M., Turowski S.G., Spernyak J.A., Tracz A., Abdelaal A.M., Sudarshan K., Puzanov I., Chatta G., Kasinski A.L, & Tang D.G. (2024). Developing Folate-Conjugated miR-34a Therapeutic for Prostate Cancer: Challenges and Promises. International Journal of Molecular Sciences, 25(4), 2123.

+ Open protocol

+ Expand

Transcriptional analysis of kidney gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cultured cells and kidney tissue were homogenized in Trizol reagent (Zymo Research; Irvine, CA). Kidney samples were homogenized using ceramic beads in a Bead Ruptor 12 (Omni international, Inc. Kennesaw, GA) homogenizer. RNA was isolated using Direct-zol RNA Miniprep Plus Kits (Zymo Research). Copies of cDNA were generated from RNA samples using a High-Capacity cDNA Reverse Transcription kit (Life Technologies). PCR was performed on a SimpliAmp Thermal Cycler (Life Technologies). The products were resolved on 1.5% agarose gel with GelRed nucleic acid stain and imaged using Biorad Chemidoc Touch (Hercules, CA) imaging system. The gene-specific oligonucleotide primer pairs used in this study were 1, UT (NM_145440.1): Forward: ATGGGGCCTTTGTGTGAGAG; Reverse: AGGCCCCTTACCAACCAATG (Product size: 378), 2, UII (NM_011910.2): Forward: CAGCTTCCAGTGCTTGAGGAA; Reverse: CTGAAGCAATGGTTCTGAGAGA (Product size: 322), and 3, β-actin (NM_007393.5): Forward: GGAACGGTGAAGGCGACAGCA; Reverse: GGGGGTGGCTTTTGGGAGGG (Product size: 187).

Peixoto-Neves D., Kanthakumar P., Kumar R., Soni H, & Adebiyi A. (2022). Loss of urotensin II receptor diminishes hyperglycemia and kidney injury in streptozotocin-treated mice. Journal of molecular endocrinology, 68(3), 167-178.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using Direct-zol RNA Miniprep Plus Kits (Zymo Research, #R2071). 1 µg of DNase I-pretreated RNA was used as input for reverse transcription using SuperScript^TM III First-strand Synthesis SuperMix (Thermo Fisher Scientific, #18080400). Gene expression was analyzed by qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems, #4367659) and a Bio-Rad CFX96 touch thermocycler, using qPCR primers listed in Supplementary Table 1.

Lu F., Ma Q., Xie W., Liou C.L., Zhang D., Sweat M.E., Jardin B.D., Naya F.J., Guo Y., Cheng H, & Pu W.T. (2022). CMYA5 establishes cardiac dyad architecture and positioning. Nature Communications, 13, 2185.

+ Open protocol

+ Expand

Huh7 and HepG2 Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Huh7 and HepG2 cells were cultured at 37°C in a humidified incubator at 5% CO₂ in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin. Different concentrations of FANA ASOs were added directly to the cell culture medium and cells were harvested 48-72hrs post treatment. AC069294.1 expressing plasmid DNA was transfected into Huh7 cells using lipofectamine 2000 (Fisher Scientific, USA), and cells were harvested 72 hrs post transfection. FANA ASOs and transfection experiments were conducted in biological quadruplicates or triplicates. Total RNA was prepared from Huh7 cells using direct-zol RNA miniprep plus kits (Zymo Research, CA, USA). Total protein was prepared from the same cells using acetone precipitation of the flow-through Trizol lysate. Briefly, after passing the lysate through the column, the flow-through was collected, four volumes of acetone were added, the samples were incubated on ice for 30 min, and then centrifuged at 15,000 g for 10 min at 4°C. The pellets were washed once with 400 μl ethanol (95-100%), air-dried, and resuspended in sample loading buffer. Total protein concentrations were measured using the Bradford method (Thermofisher Scientific, CA, USA).

Collins J.M, & Wang D. (2022). Regulation of CYP3A4 and CYP3A5 by a lncRNA: a potential underlying mechanism explaining the association between CYP3A4*1G and CYP3A metabolism. Pharmacogenetics and genomics, 32(1), 16-23.

+ Open protocol

+ Expand

Extraction and Analysis of Ribosomal RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs were extracted from sucrose gradient fractions by adding 1 volume of TRIzol and by using the Direct-zol RNA Miniprep Plus kits (ZYMO RESEARCH, #R2072). The RNAs were eluted in 60 μl of milliQ water (RNase-free) and subjected to DNase I digestion. After purification, the same amounts of RNA, unless indicated elsewhere, were used to perform primer extension analyses on the rRNAs as described below. Moreover, the same volume of RNA from sucrose fractions was also separated on native agarose gels (1%) (that do not contain formaldehyde), in 1X TBE buffer (10X TBE: 890 mM Tris base, 890 mM boric acid, 20 mM EDTA) for 3 h 30 at 50 V. After electrophoresis, the gels were either subjected to northern blotting as described below or stained with SYBR Safe stain (Invitrogen).

Hadjeras L., Bouvier M., Canal I., Poljak L., Morin-Ogier Q., Froment C., Burlet-Schlitz O., Hamouche L., Girbal L., Cocaign-Bousquet M, & Carpousis A.J. (2023). Attachment of the RNA degradosome to the bacterial inner cytoplasmic membrane prevents wasteful degradation of rRNA in ribosome assembly intermediates. PLOS Biology, 21(1), e3001942.

+ Open protocol

+ Expand

Quantifying TRPA1 and Fibronectin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following RNA purification, cDNAs were synthesized, and TRPA1 expression was determined by polymerase chain reaction (PCR) as we have previously described.^{28 (link),31 (link)} To examine fibronectin expression using quantitative PCR (qPCR), total RNA was isolated from cultured glomeruli using the Direct-zol RNA MiniPrep Plus Kits (Zymo Research). cDNAs were then synthesized from the RNA samples using a High-Capacity cDNA Reverse Transcription kit (Life Technologies). Reactions were performed in an Applied Biosystems QuantStudio 3 system (Life Technologies). GAPDH was used as the housekeeping gene control. The expression levels of gene transcripts were determined using 2^−ΔΔCt, where the Ct values of the gene of interest were first normalized to GAPDH and then to the ΔCt of the control. The gene-specific oligonucleotide primer pairs used in this study are listed in Table 1.

Soni H., Kumar R., Kanthakumar P, & Adebiyi A. (2021). Interleukin 1 beta-induced calcium signaling via TRPA1 channels promotes mitogen-activated protein kinase-dependent mesangial cell proliferation. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(7), e21729.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression Analysis in Rice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Roots of rice seedling were ground and homogenized in liquid nitrogen. Total RNA was isolated using a Direct-zol RNA Miniprep Plus Kits (ZYMO Research, Irvine, CA, USA), and cDNA was synthesized from 1.0 µg of total RNA using iScript cDNA Synthesis Kit (BIO-RAD Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. Gene expression levels were detected via real-time quantitative RT-PCR (qRT-PCR) which was performed with SsoAdvanced™ SYBR^® Green Supermix (BIO-RAD Laboratories, CA, USA) in a CFX384 Touch™ Real-Time PCR Detection System (BIO-RAD Laboratories, CA, USA). The primers used for qRT-PCR analysis are listed in Table S3. Gene expression levels were calculated via the normalization of a housekeeping gene in rice, ubiquitin (OsUBQ) (Table S3). The relative gene expression level was calculated in accordance with the 2^−ΔΔCT method.

Jamil M., Lin P.Y., Berqdar L., Wang J.Y., Takahashi I., Ota T., Alhammad N., Chen G.T., Asami T, & Al-Babili S. (2023). New Series of Zaxinone Mimics (MiZax) for Fundamental and Applied Research. Biomolecules, 13(8), 1206.

+ Open protocol

+ Expand

SARS-CoV-2 Viral Quantification Assays

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Infectious virus from experiments was quantified using plaque assays performed as previously described using Vero E6-TMPRSS2 cells [30 (link)].
To quantify viral RNA in vitro, 0.2 mL infected culture supernatants were harvested 48 h post-infection and added to 4 volumes of Trizol LS Reagent (Thermo Fisher Scientific). RNA was purified using Direct-zol RNA Miniprep Plus Kits (Zymo, Irvine, CA) according to the manufacturer’s instructions, eluted in 50 μL nuclease-free water, then amplified using iTaq™ Universal SYBR® Green One-Step Kit (Bio-Rad) with QuantStudio™ 7 Flex system (ThermoFisher Scientific). The Ct values of the N gene were normalized to the Ct values of the M-GAPDH for mouse lung tissues or HuGAPDH for HAE cells. Table S1 summarizes the sequences for primer sets.

Bills C.J., Xia H., Chen J.Y., Yeung J., Kalveram B.K., Walker D., Xie X, & Shi P.Y. (2023). Mutations in SARS-CoV-2 variant nsp6 enhance type-I interferon antagonism. Emerging Microbes & Infections, 12(1), 2209208.

+ Open protocol

+ Expand

SARS-CoV-2 Entry and Attachment Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genetically modified A549-AC cell lines (25,000 cells per well in DMEM medium containing 2% FBS) were plated in 12-well plates. On the next day, SARS-CoV-2 was used to infect pre-seeded cells at MOI = 1.0. For the virus entry assay, cells were co-incubated with SARS-CoV-2 at 37 °C for 1 h. For the viral attachment, cells were co-incubated with the virus at 4 °C for 1 h. After co-incubation, RNAs were isolated from infected cells by Trizol and Direct-zol RNA Miniprep Plus Kits (#R2071; Zymo Research, Irvine, CA) according to the manufacturer’s instructions. The relative expression levels of the SARS-CoV-2 nucleocapsid (N) protein were determined from the quantitative Real-time PCR (qRT-PCR) using the iTaq Universal One-Step RT-qPCR Kit (#1725151; Bio-Rad, Hercules, CA). Triplication of PCR reactions was included in all assays. The expression levels of ACTB were used for data normalization. The sequences of RT-PCR primers are listed in Supplementary Data 6.

Hou J., Wei Y., Zou J., Jaffery R., Sun L., Liang S., Zheng N., Guerrero A.M., Egan N.A., Bohat R., Chen S., Zheng C., Mao X., Yi S.S., Chen K., McGrail D.J., Sahni N., Shi P.Y., Chen Y., Xie X, & Peng W. (2024). Integrated multi-omics analyses identify anti-viral host factors and pathways controlling SARS-CoV-2 infection. Nature Communications, 15, 109.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!