Maxima sybr green rox qpcr master mix

An ELISA reader (StatFax-2100, Awareness Technology, Inc., Palm City, FL, USA) and CO₂ incubator (SHEL LAB, Sheldon Manufacturing NC., Cornelius, OR, USA) were used. The Q5000 (Uv-Vis spectrophotometer Q5000, Quawell, San Jose, CA, USA) was used for quantification of the concentration of RNA and cDNA, and StepOnePlus real-time thermal cycler (Applied Biosystems, Life technology, Carlsbad, CA, USA) was used for qPCR. Human hepatoma HepG2, breast cancer MCF7, and normal liver THLE2 cell lines were purchased from the VACSERA and were also a gift from Dr. Mohammed Abu El-Magd, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt. Lipopolysaccharide (LPS, from E. coli) was purchased from Sigma Aldrich, St. Louis, MO, USA. Fetal calf serum (FCS) and penicillin/streptomycin solution were purchased from Hyclone, Logan, UT, USA. RNeasy Mini Kit (#74104) and Quantiscript Reverse Transcription Kit (#205310) were purchased from Qiagen (Hilden, Germany). Finally, 2X Maxima SYBR Green/ROX qPCR Master Mix was obtained from Thermo scientific, Waltham, MA, USA, #K0221.

Genomic DNA was isolated from 200 mg of feces using the QIAamp^® DNA Stool (Qiagen, Hilden, North Rhine-Westphalia, Germany) kit. DNA concentrations and purity were determined at an absorbance of 260/280 nm by the Thermo Scientific NanoDrop 1000 Lite spectrophotometer (Wilmington, DE, USA). DNA was stored at −20 °C until use. The RA of L. reuteri was determined by qPCR using previously reported primers [30 (link)] and universal primers as normalizers of abundance of L. reuteri [31 (link)]. The PCR mixture of 10 µL contained 1 µL of DNA (5 ng), 5 μL of 2X Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Foster City, CA, USA), 1 µL of each primer at 5 pmol/µL, and 2 µL of DNAse/RNAse free water. The temperatures for L. reuteri gene amplification were as follows: 10 min at 95 °C, 40 cycles of 15 s at 95 °C, and 1 min at 56 °C. Those for universal primers were as follows: 10 min at 95 °C, 40 cycles of 15 s at 95 °C, and 1 min at 58 °C. Specific gene amplifications and the absence of primer dimers were determined by performing melting curve analyses in all cases. Duplicated sample reactions and a negative control were included in each plate. RA units of L. reuteri were obtained by the comparative method 2-ΔCt (L. reuteri Ct—universal Ct) [32 (link)]. This variable was analyzed as continuous and categorical in tertiles.

Real-time PCR with SYBR Green was used to measure the expression of target genes in HepG2 cells treated with different formulations and ratios Table 2. The expression was measured by amplifying the isolated cDNA using gene-specific primers Table 3 and a 2X Maxima SYBR Green/ROX qPCR Master Mix, following the manufacturer's protocol (Thermo scientific, USA, # K0221) and gene specific primers. The primers were designed using the web-based tool Primer 3 and were checked for uniqueness in the template sequence using BLAST. B-actin was used as the internal reference [83 (link)].Table 2

Different combination ratios between MTX IC50 and (D4& D7) formulas each alone

IC50	0.5 MTX	1 MTX	2 MTX
0.5 D4	0.5 + 0.5	0.5 + 1	0.5 + 2
1 D4	1 + 0.5	1 + 1	1 + 2
2 D4	2 + 0.5	2 + 1	2 + 2
0.5 D7	0.5 + 0.5	0.5 + 1	0.5 + 2
1 D7	1 + 0.5	1 + 1	1 + 2
2 D7	2 + 0.5	2 + 1	2 + 2

Table 3

Forward and reverse primer sequence for candidate genes

Gene	Forward primer(/5 ––– /3)	Reverse primer(/5 ––– /3)
Bax	TGCTTCAGGGTTTCATCCAG	GGCGGCAATCATCCTCTG
Bcl-2	AGGAAGTGAACATTTCGGTGAC	GCTCAGTTCCAGGACCAGGC
FoxP3	TCATCCGCTGGGCCATCCTG	GTGGAAACCTCACTTCTTGGTC
CD73 (NT5E)	ATTGCAAAGTGGTTCAAAGTCA	ACACTTGGCCAGTAAAATAGGG
CD39 (ENTPD1)	GAAGGTGCCTATGGCTGGATTAC	TGTTGGTCAGGTTCAGCATGTAG
A2AR (ADO)	AGCTGAAGCAGATGGAGAGC	AGGGATTCACAACCGAATTG
B-actin	GGATGCAGAAGGAGATCACTG	CGATCCACACGGAGTACTTG

Total RNA was extracted from the liver tissues using an RNA isolation kit (Thermo Scientific, Fermentas, #K0731, Waltham, MA, USA). Total RNA was measured by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). A reverse transcription kit (Thermo Scientific, Fermentas, #EP0451) was used to produce complementary DNA (cDNA). Then, the cDNA was magnified using 2X Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific, USA, # K0221). Table 3 shows the primers used for Bax, Bcl-2, caspase-8, and β-actin. The RT-PCR cycle parameters were 10 min at 95 °C accompanied by 40 cycles, including denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 30 s, with final elongation at 72 °C for 5 min. A StepOnePlus™ Real-Time PCR System (Applied Biosystems, Life technology (Carlsbad, CA, USA) was used for qRT-PCR. To prove the purity of the PCR products after each reaction, the division curve program was used. The critical threshold (CT) values of the target gene were normalized with quantities (CT) of a housekeeping gene (β-actin) using the 2^−∆∆Ct style to estimate the fold change in the target gene.