PCR products amplified with GoTaq DNA polymerase (Promega) were purified with Wizard SV Gel (Promega) and PCR Clean-Up System (Promega). These products were routinely cloned into pGEM-T easy (Promega) and transformed into E. coli JM109. PCRs were carried out in a final volume of 20 μl containing 1 × Green Go-Taq PCR buffer (Promega), 0.4 mM of each primer, 100 μM of dNTPs, 2.5 mM MgCl2 and 1U of Go-Taq DNA polymerase (Promega) and 5 ng of DNA. Reaction conditions for PCR amplification consisted of an initial denaturation step at 94 oC for 2 min followed by 30 cycles of: denaturation at 94 oC for 30 sec, annealing at 50–65 oC for 30 sec and extension at 72 oC for 1 min per kb, with a final extension of 10 min at 72 oC. Reactions were carried out in a MJ Research PTC 200 Thermal Cycler (MJ Research, Watertown, MA). Degenerate primers fdsf2A and fdsr4 were designed by using conserved sequences identified from an alignment of Cryptococcus neoformans var. neoformans JEC21(AAW43830), Lactarius chrysorrheus (BAD15361) and Ustilago maydis 521 (XP_757593) and used to amplify a region of Cp-fds gene. To generate a ggs PCR product, degenerate primers pair ggs27 and ggs29, originally designed by Zhang et al.27 (link) were used.
Gotaq dna polymerase
Manufactured by Promega
Sourced in United States, Germany, United Kingdom, France, Italy, Argentina, Switzerland, Japan
GoTaq DNA polymerase is a thermostable DNA polymerase enzyme used for DNA amplification. It catalyzes the polymerization of nucleotides into DNA strands in the presence of a DNA template and primers.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (52 mentions)
Rneasy mini kit, by Qiagen (24 mentions)
Trizol, by Thermo Fisher Scientific (24 mentions)
Pgem t easy vector, by Promega (20 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (17 mentions)
T100 thermal cycler, by Bio-Rad (16 mentions)
Green gotaq reaction buffer, by Promega (16 mentions)
Green gotaq flexi buffer, by Promega (15 mentions)
Qiaquick pcr purification kit, by Qiagen (14 mentions)
Mgcl2, by Promega (14 mentions)
M mlv reverse transcriptase, by Promega (13 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (13 mentions)
Gotaq flexi buffer, by Promega (12 mentions)
Qiaquick gel extraction kit, by Qiagen (11 mentions)
Gotaq reaction buffer, by Promega (11 mentions)
Reverse transcription system, by Promega (10 mentions)
Rneasy kit, by Qiagen (10 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (9 mentions)
Dntps, by Promega (8 mentions)
Colorless gotaq reaction buffer, by Promega (8 mentions)
819 protocols using gotaq dna polymerase
1
Cloning and Amplification of Fungal Genes
2
Nested PCR for DMD and COL25A1 Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of the DMD messenger was done using a nested PCR from exons 51–54, using GoTaq DNA polymerase (Promega, Charbonnieres, France) and following amplification conditions: the first reaction was performed with specific primers (forward: 5′-GTTACTCTGGTGACACAACC-3′ and reverse: 5′-ATGTGGACTTTTCTGGTATC-3′) for 25 cycles (95°C/1 min; 50°C/1 min; 72°C/1 min). Then, 1 μL of the first reaction was amplified for 30 cycles (forward: 5′-ACTAGAAATGCCATCTTCCT-3′ and reverse: 5′-CAAGTCATTTGCCACATCTA-3′).
Detection of the COL25A1 messenger was done using a nested PCR from exons 19–23, using GoTaq DNA polymerase (Promega) and following amplification conditions: the first reaction was performed with specific primers (forward: 5′-TAAGGCTTCGTGGAGGTTGC-3′ and reverse: 5′-TCCTCAAGGAGAACCAGGCT-3′) for 25 cycles (95°C/1 min; 60°C/1 min; 72°C/1 min). Then, 1 μL of the first reaction was amplified for 30 cycles (forward: 5′-TGATCTCAGTGGCTCCTTGA-3′ and reverse: 5′-GAACAAAAGGTGAACGGGGG-3′). Final PCR products were migrated on a 2% agarose gel and revealed with ethidium bromide staining.
Detection of the COL25A1 messenger was done using a nested PCR from exons 19–23, using GoTaq DNA polymerase (Promega) and following amplification conditions: the first reaction was performed with specific primers (forward: 5′-TAAGGCTTCGTGGAGGTTGC-3′ and reverse: 5′-TCCTCAAGGAGAACCAGGCT-3′) for 25 cycles (95°C/1 min; 60°C/1 min; 72°C/1 min). Then, 1 μL of the first reaction was amplified for 30 cycles (forward: 5′-TGATCTCAGTGGCTCCTTGA-3′ and reverse: 5′-GAACAAAAGGTGAACGGGGG-3′). Final PCR products were migrated on a 2% agarose gel and revealed with ethidium bromide staining.
3
Single-Stranded DNA Amplification via Nested Asymmetric PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the case of minuscule amounts of samples, we prepared single-stranded DNA through a nested asymmetric PCR amplification. The amplification could be accomplished in <1 h. For the exponential amplification, we used 0.8 µM of forward and reverse primers (IDT), and 5 units of GoTaq DNA polymerase (Promega) in 1× GoTaq buffer containing 2.5 mM dNTPs. This was followed by a linear asymmetric PCR amplification, where we used excess reverse primer only, in the presence of GoTaq DNA polymerase (Promega) in 1× GoTaq buffer containing 2.5 mM dNTPs. The following thermocycling conditions were used for the entire processing: 95 °C for 5 min, 35 cycles of 95 °C for 30 s and 52 °C for 60 s, and a final 4 °C holding step. The PCR solution was used directly for all subsequent measurements.
4
Bacillus cereus DNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GoTaq®DNA polymerase (M3005) was purchased from Promega (Madison, WI, USA). Bacillus cereus (ATCC 21768) were purchased from ATCC. 2′-(4-Hydroxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5′-bi-1H-benzimidazole trihydrochloride hydrate and 2′-(4-Hydroxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5′-bi-1H-benzimidazole trihydrochloride hydrate, bisBenzimide (HEPES) were obtained from Sigma-Aldrich. (St. Louis, MO, USA) Go Taq® DNA polymerase (M3005) was purchased from Promega. NI PXIe-1060Q (NI) was obtained from National Instruments. QuickExtract™ DNA extraction solution 1.0 (QE09050) was obtained from Epicentre. The thermal cycler (C1000Touch™) was obtained from Bio-Rad (Hercules, CA, USA). LIAS Slite 140 was purchased from Avegene Life Sciences. The plotting cutter (FC4600C-50 PRO) was obtained from GRAPHTEC (Tokyo, Japan).
5
PCR Amplification and Allelic Analysis of Transformed Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from T0 plants was isolated as described above. PCR was carried out using the GoTaq DNA polymerase (Promega, Fitchburg, WI, United States) with the following thermocycler conditions: one cycle of initial denaturation for 4 min at 94°C, followed by 34 cycles for 15 s at 94°C, 45 s at 56°C and 1 min at 72°C and a final extension of 5 min at 72°C. Amplicons were visualized on 1% (w/v) agarose gels. Allelic mutations of positive transformation events were identified by insertion/deletion presence. Selected transformation events were amplified with the Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, United States). Then, purified PCR products were cloned into the Zero Blunt TOPO PCR Cloning vector (Thermo Fisher, Carlsbad, CA, United States), and transformed into DH5α competent cells (Thermo Fisher, Carlsbad, CA, United States). Colonies carrying the alleles from each event were Sanger sequenced.
6
Generation and Characterization of Sall1-Deficient Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sall1flox mice were produced as described20 (link)27 (link). Foxd1GFPCre (012463) and R26R-tdTomato (007905) mice were obtained from the Jackson Laboratory3 (link)29 (link). The primers used for genotyping were as follows: Cre1 (5′–AGGTTCGTTCACTCATGGA–3′) and Cre2 (5′–TCGACCAGTTTAGTTACCC–3′) for the Cre allele (250 bp); Sall1 flox2 (5′–CCTCTGCCCGAGAGATCG–3′), Sall1flox3 (5′–GGCGCGTCTGATTTTATTTC–3′) for the Sall1 allele (wild-type: 220 bp; mutant: 280 bp). Polymerase chain reaction (PCR) amplifications were performed using GoTaq DNA polymerase (Promega) by denaturation at 95 °C for 2.5 min, followed by 35 cycles of 95 °C for 30 s, 58 °C for 60 s, and 72 °C for 30 s, and a final extension at 72 °C for 7 min. All animal experiments were performed in accordance with the institutional guidelines and approved by the licencing committee of Kumamoto University (#A27-018).
7
Sanger Sequencing and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All variants, which passed calling quality filter (≥ 20), were further investigated by Sanger sequencing were amplified from a genomic DNA sample by polymerase chain reaction (PCR), using standard buffer condition of GoTaq DNA Polymerase (Promega, Madison, WI, USA) and gene-specific oligonucleotide primers generated using Prime Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) [50 (link)]. PCR products were separated and visualized using QIAxcel (an automated capillary electrophoresis system by Qiagen). Subsequently, amplicons were subjected to direct sequencing using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Sequences were determined using the automated AB3130xl (Applied Biosystems). Results were analyzed with Chromas Lite software (Technelysium, South Brisbane QLD, Australia) and Mutation Surveyor software (SoftGenetics, State College, PA, USA). For convenience, all primer sequences used are listed in Suppl. Table 3 .
8
Genomic DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was prepared using the QIAamp DNA Blood Mini Kit (QIAGEN) according to the manufacturer’s instructions, and 100 ng of gDNA was amplified by PCR with GoTaq DNA polymerase (Promega). Sequences and specifications of the primers are shown in Table S1 .
9
Amplification of Epichloë og_0042 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification of og_0042 from Epichloë genomic DNA templates was performed using primers og_0042_F (ACCCTGAAGGCGAATGTTAC) and og_0042_R (GCCGACCTCGACGCCAAATG) with GoTaq DNA polymerase (Promega), following the manufacturer’s instructions for a 30 cycles amplification with an annealing temperature of 56°C. Template integrity control amplifications targeting the tefA gene were performed under the same conditions using the primers tef1-exon1d-1 (GGGTAAGGACGAAAAGACTCA) and tef1-exon6u-1 (CGGCAGCGATAATCAGGATAG) (Moon et al. 2002 (link)).
10
GPR35 Isoform Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
THP-1 monocytes (express
GPR35a isoform) were maintained in RPMI-1640
(Invitrogen, Waltham, MA) supplemented with 10% FBS, 2 mMl -glutamine, and 1% penicillin/streptomycin. HT-29 cells (express
GPR35b isoform) were maintained in Dulbecco’s Modified Eagle
Medium supplemented with 10% FBS and 1% penicillin/streptomycin. Total
mRNA was isolated from the cells using the RNeasy mini kit from QIAGEN
(Germantown, MD). RNA concentrations were determined by a Nanodrop
ND-1000 spectrophotometer. One microgram of RNA was transcribed using
the Qiagen QuantiTect Rev. Transcription Kit. Synthesized cDNA products
and primers for each gene were subjected to PCR with Promega Go-Taq
DNA polymerase (Madision, WI). Specific primers are listed inTable S1 .
GPR35a isoform) were maintained in RPMI-1640
(Invitrogen, Waltham, MA) supplemented with 10% FBS, 2 mM
GPR35b isoform) were maintained in Dulbecco’s Modified Eagle
Medium supplemented with 10% FBS and 1% penicillin/streptomycin. Total
mRNA was isolated from the cells using the RNeasy mini kit from QIAGEN
(Germantown, MD). RNA concentrations were determined by a Nanodrop
ND-1000 spectrophotometer. One microgram of RNA was transcribed using
the Qiagen QuantiTect Rev. Transcription Kit. Synthesized cDNA products
and primers for each gene were subjected to PCR with Promega Go-Taq
DNA polymerase (Madision, WI). Specific primers are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!