Embryos were collected on apple juice agar plates and fixed and stained as described previously [12 ]. Antibodies used were goat anti-GFP (1:1500) (Molecular Probes) and mouse anti-β-Gal (1:750) (Promega), and Alexa Fluor secondary antibodies (Invitrogen) Imaging was done on Leica DMI 4000B and Leica SP5 microscopes. Hemocyte counts were conducted under fluorescent microscopy at 40X, assessing 10 independent embryos per genotype and stage. Standard deviations and p values by Student’s t-test were calculated.
Goat anti gfp
Manufactured by Thermo Fisher Scientific
Goat anti-GFP is a polyclonal antibody raised in goats against green fluorescent protein (GFP). This antibody can be used to detect and visualize GFP-tagged proteins in various experimental applications.
Automatically generated - may contain errors
Lab products found in correlation
Mouse anti β gal, by Promega (1 mentions)
Alexa fluor secondary antibody, by Thermo Fisher Scientific (1 mentions)
Dmi4000b, by Leica (1 mentions)
Tcs spe system, by Leica (1 mentions)
Mouse anti crb, by Developmental Studies Hybridoma Bank (1 mentions)
Mouse anti 2a12, by Developmental Studies Hybridoma Bank (1 mentions)
Rat anti de cad, by Developmental Studies Hybridoma Bank (1 mentions)
Rabbit anti neun, by Merck Group (1 mentions)
Lsm 510 meta confocal laser scanning microscope, by Zeiss (1 mentions)
Alexa fluor 488 conjugated goat anti rabbit igg, by Jackson ImmunoResearch (1 mentions)
Citra solution, by BioGenex (1 mentions)
Rabbit anti cd45, by Cell Signaling Technology (1 mentions)
Rabbit anti iba1, by Fujifilm (1 mentions)
Mouse anti zo 1, by Thermo Fisher Scientific (1 mentions)
Donkey anti mouse alexa 647, by Jackson ImmunoResearch (1 mentions)
Donkey anti goat cy3, by Jackson ImmunoResearch (1 mentions)
Donkey anti rabbit cy3, by Jackson ImmunoResearch (1 mentions)
Donkey anti mouse cy3, by Jackson ImmunoResearch (1 mentions)
Rabbit anti gfp, by Thermo Fisher Scientific (1 mentions)
Goat anti rabbit alexa 488, by Thermo Fisher Scientific (1 mentions)
8 protocols using goat anti gfp
1
Embryonic Hemocyte Quantification
2
Immunostaining and in situ Hybridization in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We followed standard protocols for immunostainings and in situ hybridisations. Embryos were staged as described [42 ]. Imaginal discs were obtained by dissecting third instar larvae.
The following primary antibodies and dilutions were used: mouse anti-2A12 (recognises Gasp, 1:10), rat anti-DEcad (1:100), and mouse anti-Crb (1:20) from Developmental Studies Hybridoma Bank, DSHB; rbb anti-Verm (1:300) from S. Luschnig; goat anti-GFP (1:600) Molecular Probes and Roche; ck anti-ßGal (1:500) abCAM; GP anti-Uif (1:400) from R. Ward; and rbb anti-Pio (1:100) from M. Affolter. CBP (chitin-binding probe) conjugated with Cy3, Cy2 and Cy5 was used at 1:300 (generated by N. Martin). WGA conjugated with Alexa-555, -488, and -647 was used at 1:300 (Molecular Probes). Cy3-, Cy2- and Cy5-conjugated secondary antibodies (Jackson ImmunoResearch) were used at 1:300.
A reb riboprobe was generated using the following primers:
The following primary antibodies and dilutions were used: mouse anti-2A12 (recognises Gasp, 1:10), rat anti-DEcad (1:100), and mouse anti-Crb (1:20) from Developmental Studies Hybridoma Bank, DSHB; rbb anti-Verm (1:300) from S. Luschnig; goat anti-GFP (1:600) Molecular Probes and Roche; ck anti-ßGal (1:500) abCAM; GP anti-Uif (1:400) from R. Ward; and rbb anti-Pio (1:100) from M. Affolter. CBP (chitin-binding probe) conjugated with Cy3, Cy2 and Cy5 was used at 1:300 (generated by N. Martin). WGA conjugated with Alexa-555, -488, and -647 was used at 1:300 (Molecular Probes). Cy3-, Cy2- and Cy5-conjugated secondary antibodies (Jackson ImmunoResearch) were used at 1:300.
A reb riboprobe was generated using the following primers:
Forward: 5′- AACTGTGCCTCGGCGCTAGTC
Reverse: 5′- AGCAGTCGAAACACGCAGCTT
3
Immunohistochemical Analysis of Cdk5 and Associated Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals were perfused transcardially with PBS solution followed by 4% PFA. Brains were dissected and placed in 4% PFA for 24 h, then block-sectioned and dissected. The 1 cm thick coronal slab which included the injection area (Bregma 1.54 mm) in the center was paraffin-embedded and serially sectioned at 5 μm on a rotary microtome. Slides underwent antigen retrieval (citra solution, BioGenex; 95 °C for 10 min), and were then incubated with 0.3% H2O2 to remove the endogenous peroxidase activity. Nonspecific antibody binding was blocked with 3% goat serum in 0.3% Triton-X in PBS for 1 h. Primary antibodies included mouse anti-Cdk5 (1:50, PhosphoSolutions), goat anti-GFP (1:400, Thermo scientific) and rabbit anti-NeuN (1:1000, Millipore). For double labeling, primary antibodies were simultaneously incubated (Cdk5/GFP, cdk5/NeuN). For GFP and NeuN, Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:500, Jackson Immunoresearch) were used. For Cdk5, a biotin-conjugated goat anti-mouse IgG (1:2000, Thermo Scientific), followed by streptavidin-HRP and cyanine 3 tyramide (1:50, PerkinElmer), was used. Images were captured using a Zeiss LSM510 Meta confocal laser scanning microscope. Quantitative immunoblot analysis was conducted using previously described standard methodology68 (link).
4
Perfusion-Based Tissue Preparation and Immunostaining
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were anesthetized with 150 mg/kg ketamine and xylazine 15 mg/kg followed by transcardial perfusion with 20 ml cold 1XPBS followed by cold 4% buffered paraformaldehyde (pH 7.4) and tissue retrieval and processing as previously described [34 (link), 61 (link), 63 (link), 64 (link)]. Immunohistochemistry was performed as previously described [34 (link), 59 (link), 60 (link)], and incubated with primary antibodies (goat anti-GFP, ThermoFisher; rabbit anti-Iba1, WAKO; rat Cd11b, Abcam; rabbit anti-CD45, Cell signaling). Images were acquired using a Nikon ECLIPSE Ti2 Inverted confocal microscope with a motorized stage and a Nikon C2 laser system (Nikon, Melville, NY).
5
Immunostaining Procedure for Zebrafish Embryos
6
Imaging GFP Expression in Kidney Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten micrometer frozen sections of formalin-fixed tissues were treated with 0.1% Triton X-100. Blocking was performed with 5% goat serum plus 5% bovine serum albumin followed by overnight incubation with rabbit anti-GFP antibody (1:400; Invitrogen). Anti-GFP antibodies were detected by fluorescence-conjugated goat antirabbit antibody IgG Alexa Fluor 488 (1:500; Invitrogen) and treatment with mounting medium (Vector). Tissues were then examined with a Zeiss 510 confocal microscope using FITC fluorescence filter (Carl Zeiss Microimaging, Thornwood, NY).
To confirm the location of the GFP expression in the kidney, multiple immunofluorescence study was performed using a podocyte marker, rabbit anti-wt1 (1:200; Santa Cruz), and goat anti-GFP (1:400; Invitrogen) antibody overnight at 4 °C, followed by incubation with Alexa Fluor 488-labeled donkey antirabbit IgG (1:200; Invitrogen) and Alexa Fluor 546-labeled donkey antigoat IgG (1:200; Invitrogen) at room temperature for 2 hours. Sections were washed, mounted with VECTASHIELD mounting medium with DAPI (4’,6-diamidino-2-phenylindole) (Vector Laboratories), and then examined by laser confocal microscopy (LSM 710; Carl Zeiss AG).
To confirm the location of the GFP expression in the kidney, multiple immunofluorescence study was performed using a podocyte marker, rabbit anti-wt1 (1:200; Santa Cruz), and goat anti-GFP (1:400; Invitrogen) antibody overnight at 4 °C, followed by incubation with Alexa Fluor 488-labeled donkey antirabbit IgG (1:200; Invitrogen) and Alexa Fluor 546-labeled donkey antigoat IgG (1:200; Invitrogen) at room temperature for 2 hours. Sections were washed, mounted with VECTASHIELD mounting medium with DAPI (4’,6-diamidino-2-phenylindole) (Vector Laboratories), and then examined by laser confocal microscopy (LSM 710; Carl Zeiss AG).
7
Immunofluorescence analysis of intestinal organoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Established organoids were passaged and replated in a 1:1 ENR:Matrigel solution; 30-μl domes were plated on Nunc Lab-Tek II Chamber Slides and incubated overnight in 200 μl medium at 37°C. Organoids were than treated with 5 ng/ml of IL-13 in ENR or simultaneously with Hpb-CM for 48 h. After stimulation, domes were fixed in 10% formalin for 30 min at room temperature (RT), and permeabilized with PBS-T (PBS + Triton 0.5%) for 15 min. The samples were blocked with 200 μl blocking solution (3% BSA in PBS) for 1 h at RT. Organoids were incubated with primary antibodies overnight at 4 °C, followed by incubation with secondary antibodies at RT for 1 h. The nuclei were stained with DAPI (1 µg/ml). Specific antibodies include anti-mouse/rat Ki67 eFluor 660 (Invitrogen), anti-mouse CD326 (EpCAM) Alexa Fluor 488 (BioLegend), goat anti-GFP (Invitrogen), anti-goat IgG Alexa Fluor 555 (Invitrogen), rabbit anti-mouse Dclk (Abcam), rabbit anti-mouse Muc2 (Abcam), and goat anti-rabbit IgG Alex Fluor 555. All fluorescent images were taken on a Zeiss Confocal LSM700, using a 20×/0.8 M27 Plan-Apochromat objective, after mounting with Invitrogen Prolong Glass Antifade Mounting solution. Tile scanning (5 × 5 tiles) was performed as well as Z-stacking to generate images analyzed using Fiji software (Schindelin et al., 2012 (link)).
8
Immunofluorescence Staining of C. elegans Gonads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gonads from 20 h post L4 worms were dissected in M9 solution (0.3% H2PO4, 0.6% Na2HPO4, 0.5% NaCl and 1 mM MgSO4). Slides were freeze-cracked in liquid nitrogen, then immersed at -20 °C in methanol, methanol/acetone (1:1) and acetone respectively for 5 min, followed by three washes in PBS for 5 min each time. Slides were blocked in 0.3% BSA in PBS for 30 min at 37 °C in a humid chamber. Primary antibodies were diluted in Ab buffer (1% BSA, 0.1% Tween-20, 0.05% sodium azide in 1X PBS). Slides were incubated for 90 min at room temperature followed by three washes in PBS for 5 min. Primary antibodies used in this study were: goat anti-CEP-1 (1:250 dilution)25 (link), goat anti-GFP (1:150 dilution, Invitrogen); rabbit anti-RAD-51 (1:200 dilution)18 (link). Appropriate secondary antibodies were conjugated with donkey anti-goat Alexa Fluor 488 or goat anti-rabbit Texas Red (1:400 dilution, Invitrogen). Slides were incubated for 60 min in the dark at room temperature, followed by three washes in PBS + 0.1% Tween-20 for 5 min each time. Slides were mounted with Prolong Gold Antifade reagent with DAPI (Life Technologies).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!