Mesa blue qpcr mastermix plus for sybr assay

Samples from cultured C-28/I2 chondrocytes were analyzed using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Real-time RT-PCR was performed with specific primers (Table 1) to allow calculation of the relative abundance of transcripts. The reactions were performed using 10 μl of SYBR Green Master Mix (MESA BLUE qPCR MasterMix Plus for SYBR Assay; Eurogentec, Cologne, Germany) and 3 μl of cDNA. The cycle parameters were 5 minutes at 95°C and 40 three-step cycles of 10 seconds at 95°C, 15 seconds at 60°C and 20 seconds 72°C. Standard curves were generated for each gene using a plasmid dilution series containing the target sequences. All quantitative RT-PCRs (qRT-PCRs) were performed in triplicate, and the changes in gene expression were calculated by the 2-^ΔΔCt relative quantitation method. Analysis of the data yielded values relative to the mRNA concentration.

HeLa cell monolayers were infected with WR (MOI of 10) in the absence or presence of H4 for 2, 4, or 8 h. Total RNA was harvested from infected cells using the Qiagen RNeasy kit according to the manufacturer's instructions. Subsequently, 1 μl of total RNA was reverse transcribed into single-stranded cDNA with SuperScript II reverse transcriptase (Thermo Fisher Scientific) and oligo(dT) primers. Amplification of J2 (early) from 2-h samples, G8 (intermediate) from 4-h samples, F17 (late) from 8-h samples, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA from all time points was performed by qPCR (Mesa Blue qPCR MasterMix Plus for SYBR assay; Eurogentec) using primers specific for VACV J2R (5′-TACGGAACGGGACTATGGAC-3′ and 5′-GTTTGCCATACGCTCACAGA-3′), G8R (5′-AATGTAGACTCGACGGATGAGTTA-3′ and 5′-TCGTCATTATCCATTACGATTCTAGTT-3′), F17R (5′-ATTCTCATTTTGCATCTGCTC-3′ and 5′-AGCTACATTATCGCGATTAGC-3′), and GAPDH (5′ AAGGTCGGAGTCAACGGATTTGGT-3′ and 5′-ACAAAGTGGTCGTTGAGGGCAATG-3′). Viral mRNA threshold cycle (C_T) values are displayed as abundance normalized against GAPDH.

Total RNA from monocytes or macrophages was isolated after treatments using the RNAeasy mini kit (Qiagen) including a DNase step (Qiagen). RNA was then reverse transcribed in the presence of 2.5 mM oligo-dT using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche), following the manufacturer’s instructions. Five ng of cDNA was amplified using the Mesa Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec) in the Light Cycler LC480 (Roche). mRNA expression was normalized to the levels of ribosomal protein L13a, RPL13A (NM_012423.2), which was used as housekeeping gene. The glucocorticoid-induced leucine zipper (GILZ) gene expression was used as a marker of glucocorticoid induction [49 (link)]. The relative level of expression of a gene between sample 1 (treated) and sample 2 (control) was calculated using the ΔΔCt formula: 2^{−(Ct1−Ct RPL13A 1)−(Ct2−Ct RPL13A 2)}. Normalized Ct values (mean of controls) were used to calculate the gene expression ratio between two samples. Primers (S1 Table) were designed either using the Probe Finder software (http://qpcr.probefinder.com/organism.jsp; Roche Life sciences) or manually for specificity reasons.

Total RNA was extracted from cells using Qiagen RNeasy kit. Excess DNA was removed by incubation with DNase I (Invitrogen) for 15 min at room temperature, followed by inactivation for 10 min at 65°C in 25 nM of EDTA. Superscript III (Invitrogen) was used to synthesise cDNA using random primers according to manufacturer’s instructions. All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 2. Primers for cellular genes MMP1 and MMP3 were obtained from SinoBiological (HP100549 and HP100493 respectively). Cycling was carried out in a Lightcycler (Roche), and relative expression was determined using the ΔΔCT method [35 (link)], using 18s RNA as reference.

Total RNA was extracted from cells using Qiagen RNeasy kit. Excess DNA was removed by incubation with DNase I (Invitrogen) for 15 min at room temperature, followed by inactivation for 10 min at 65 °C in 25 nM of EDTA. Superscript III (Invitrogen) was used to synthesize cDNA using random primers according to manufacturer’s instructions. All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA; GFP was amplified with forward primer GAAGCAGCACGACTTCTTCAA and reverse primer AGTCGATGCCCTTCAGCTC. Cycling was carried out in a Lightcycler (Roche), and GLuc or GFP mRNA levels determined by the ΔΔCt method using 18 s RNA as reference gene (18 s F: CCAGTAAGTGCGGGTCATAAGC; 18 s R: GCCTCACTAAACCATCCAATCGG).