The largest database of trusted experimental protocols
Sourced in United States

The CT26.WT cell line is a colon carcinoma cell line derived from a mouse. It is a widely used model in cancer research. The core function of this cell line is to serve as an in vitro model for studying various aspects of cancer biology.

Automatically generated - may contain errors

35 protocols using ct26 wt

1

Murine and Human Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The murine cell lines CT26.WT (ATCC CRL-2638) (colon carcinoma, female), B16-F10 (CRL-6475) (malignant melanoma, male) and the human cell line SJSA-1 (CRL-2098) (osteosarcoma, male) were purchased from ATCC. At arrival, the cell lines were expanded and aliquots were frozen at low passage numbers. None of the cell lines were further authenticated. B16-F10 p53−/−(clone 8) was generated from the B16-F10 cell line,40 (link) expanded and frozen.
Prior to experiments, the cell lines were thawed and allowed to adjust to culture for a minimum of one week, until normal growth rate was obtained. All cell lines were grown in RPMI-1640 medium (R8758 Sigma Aldrich) supplemented with 10% heat inactivated FBS (SV30160.03, Hyclone) and 100 U/mL penicillin and 100 μg/mL streptomycin (5140-122, Gibco). The cell lines were sub-cultivated before reaching confluency, at least twice per week. All cell cultures were maintained at 37°C and 5% CO2. None of the cell lines were maintained in culture for more than five months.
The cultures were tested and confirmed to be negative for mycoplasma infection every second month, using the MycoAlert Plus Detection kit (LT07-710, Lonza) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
2

Cell Culture Maintenance Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
A-431 (CRL-1555), MDA-MB-231 (HTB-26) and CT26.WT (CRL-2638) cells were obtained from ATCC (Manassas, VA, USA) and maintained in DMEM (A-431) or RPMI-1640 medium (Sigma Aldrich, St Louis, MO, USA) supplied with 10% FCS, 100 U/mL penicillin and 100 μg/mL streptomycin. The cell lines were used between passage numbers 1–25 and routinely checked for Mycoplasma sp. infections.
+ Open protocol
+ Expand
3

Isolation and Transfection of Primary Human Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical cords obtained from local hospitals under the University of California, Irvine, Institutional Review Board approval and were cultured as previously described [4 (link)]. Normal human lung fibroblasts (NHLFs) were purchased from Lonza and cultured in M199 containing 10% FBS. Human cardiac microvascular endothelial cells (HMVECs) were purchased from Lonza and maintained similarly to HUVEC. The BALB/c colon carcinoma cell line CT26.WT (ATCC) was cultured in RPMI (Life Technologies) supplemented with 10% fetal bovine serum.
HUVEC were transfected with siRNA using Lipofectamine 2000 in Opti-MEM (Invitrogen). The sequences of the siRNA to human raptor and Rictor (Thermo Scientific) are as follows: Raptor 5′GGGAGAAGCUGGAUUAUUUUU3′ and Rictor 5′GGAAAUAAGGCGAGGUCUAUU3′. siRNA targeting Rheb and Sin1 were ON-TARGETplus siRNA from Thermo Scientific. A non-targeting scrambled control siRNA (Thermo Scientific) was used in all experiments to assess sequence independent effects of siRNA delivery. Transfection efficiency was determined by Western blot (see below).
+ Open protocol
+ Expand
4

Probiotic Inhibition of Colorectal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
This study was approved by the Special Committee on Scientific Research and Academic Ethics of Inner Mongolia Agricultural University (No. 2020-049). Specific pathogen-free (SPF) BALB/c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Six- to 8-week-old mice were raised and housed under SPF conditions and received sterilized feed and water. The mouse colorectal cancer cell line, CT26.WT (ATCC® CRL-2638), was cultured in RPMI-1640 medium (Gibco, USA) containing 10% fetal bovine serum (Gibco, USA) in a humidified incubator (Thermo, USA) at 37°C, 5% CO2. The probiotic strain, Probio-M9, was provided by the Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University, China.
+ Open protocol
+ Expand
5

Establishing Sunitinib-resistant Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human colorectal adenocarcinoma cell line HT-29 (ATCC HT-38™) and the murine colorectal carcinoma cell line CT26.WT (ATCC CRL-2638™) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were subcultured 2–3 times a week in McCoy’s 5a medium (Sigma-Aldrich, St. Louis, MO, USA) and RPMI-1640 (Sigma-Aldrich), respectively. The culture media were supplied with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin and 100 U/mL streptomycin (Sigma-Aldrich). Sunitinib-resistant HT-29 cells, named HT-29/SR, were generated by continuous exposure to 2 µM sunitinib for up to 5 months and the resistance was routinely verified during this time frame. Untreated parental HT-29 cells were cultured in parallel with the HT-29/SR cells. The cell lines were maintained at 37 °C in a humidified atmosphere containing 5% CO2.
+ Open protocol
+ Expand
6

Zyxin Knockdown in Mouse Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lines used in this study were NIH3T3 (ATCC CRL-1658), MEF (ATCC SCRC-1040) and CT26.WT (ATCC CRL-2638). Dulbecco’s Modified Eagle Medium (DMEM) High Glucose (Invitrogen, CA, United States) with added supplements was used for cell culture. Cells were cultured in DMEM with 10% Fetal Bovine Serum (Invitrogen) and 1% penicillin-streptomycin combination antibiotic (Invitrogen). Cells were seeded at 80% confluence and transiently transfected with 75 nM pre-designed Stealth RNAi™ siRNA targeting mouse zyxin (Invitrogen, siRNA ID: MSS238956) using Lipofectamine 3,000 (Thermo Fisher Scientific) according to manufacturer’s instruction. To test zyxin knockdown efficiency, zyxin protein level was determined by western blot at 72 h.
+ Open protocol
+ Expand
7

MUC1-Expressing Tumor Cell Lines for Preclinical Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cell culture reagents were purchased from Biowest and Serana. Tumor cell lines ZR-75-1, MCF-7, HSC-4, CaoV-3 and T-47D as well as the human NK cell line KHYG-1 and murine T cell line CTLL-2 were obtained from DSMZ or ATCC and cultured in the respective recommended medium under standard conditions. KHYG-1 and CTLL-2 were cultured in presence of 10 ng/mL IL-2 (PeproTech, Rocky Hill, NJ, USA).
For in vivo studies, the murine tumor cell lines B16.F10 and CT26.wt (ATCC) were stably transfected by electroporation (Amaxa) with a plasmid coding for human MUC1 (40 tandem repeats) and confirmed for TA-MUC1 expression in vitro and in vivo in mice by flow cytometry and immunohistochemistry using GT-00A. Cells were cultured in standard medium +100 nM methotrexate (Hexal, Holzkirchen, Germany) as selection pressure. For the metastasis model, hMUC1-B16.F10 cells were further transduced to stably express firefly luciferase (110 RLU/cell) enabling detection of metastasis. Origin, TA-MUC1 and IL-15R expression status of cell lines are indicated in Table S1.
Peripheral blood mononuclear cells (PBMCs) were prepared from commercially available buffy coats (DRK Berlin) or leukapheresates (Charité Berlin) of healthy donors by Biocoll separation (Biochrom, Cambridge, UK) and density gradient centrifugation. PBMCs from leukapheresate products were stored frozen in liquid nitrogen.
+ Open protocol
+ Expand
8

Characterization of Cell Lines for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T (RRID:CVCL_4401) and Rat-1 (RRID:CVCL_0492) were obtained from Takara Bio (Kusatsu, Japan) and RIKEN BRC (Tsukuba Japan), respectively. Expi293 (RRID:CVCL_D615) and CHO/G16 were obtained from Thermo Fisher Scientific. KHYG-1 (RRID:CVCL_2976) and Ramos (RRID:CVCL_0597) were obtained from JCRB Cell Bank. The 293c18 (RRID:CVCL_6974), CT26.WT (RRID:CVCL_7256), and EMT6 (RRID:CVCL_1923) cell lines were obtained from ATCC. Colon26 (RRID:CVCL_0240) was obtained from Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University (Sendai, Japan). HEK293T and Rat-1 were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 2 mmol/L L-glutamine containing 10% fetal bovine serum (FBS). Ramos and KHYG-1 cells were cultured in an RPMI-1640 medium with 2 mmol/L L-glutamine containing 10% FBS and MEM. In KHYG-1 cells, 100 units/mL of recombinant human IL2 (PeproTech) were added to the culture medium. CT26.WT, Colon26, and EMT6 were cultured in DMEM with 10% FBS. The method for the generation of gene-transfected cells is described in the Supplementary Materials. All cell lines were used within 10 passages after thawing. Cell authentication was routinely performed by comparing cell morphology and growth properties with suppliers’ data. The cells were not tested for mycoplasma contamination.
+ Open protocol
+ Expand
9

Establish Cell Lines for Tumor Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
Baby Hamster kidney (BHK), BALB/c colon carcinoma (CT26.WT [ATCC CRL-2638]), and FVB prostate carcinoma (MyC-CaP [ATCC CRL-3255]) cell lines were obtained from the American Type Culture Collection. Fluc-expressing CT26 and MyC-CaP cells (CT26.Fluc and MyC-CaP.Fluc) were generated by stable transfection of pGL4.20_Fluc plasmid.
BHK cells were maintained in α-modified minimum essential medium (α-MEM) (Corning Cellgro) with 5% fetal calf serum (FCS, Gibco) and 100 mg/mL penicillin-streptomycin (Corning Cellgro). CT26.Fluc and MyC-CaP.Fluc cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 4.5 g/L glucose (Corning Cellgro) supplemented with 10% FCS, 100 mg/mL penicillin-streptomycin, 7.5 μg/mL puromycin, or 400 μg/mL gentamycin, respectively. All cell lines were cultured at 37°C and 5% CO2.
+ Open protocol
+ Expand
10

Colon Adenocarcinoma Cell Line Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human and mouse colon adenocarcinoma cell lines SW480 and CT26.WT (ATCC), respectively, were employed. Cells were plated in DMEM/F12 or RPMI-1640 (both from Gibco), for SW480 and CT26.WT, respectively, supplemented with 10% fetal bovine serum (Corning) and 1% streptomycin/amphotericin (Gibco) (complete medium), at 37 ºC in a 5% CO2 incubator.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!