The Illumina paired-end adaptor was ligated to ∼500 ng purified sonicated AluI-digested DNA using the NEBNext ultra DNA library kit for Illumina (New England Biolabs, E7370) according to the manufacturer's instructions. The ligated DNA samples were purified without size selection using AMPure XP beads at a 1:1 ratio (Beckman, A63880). The DNA (50–100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs, M0531) or the Q5 Hot Start HiFi PCR master mix (7–10 cycles; New England Biolabs, E6625AA). Library quality was checked in an agarose gel. Sequencing was performed using either an Illumina HiSeq 2500 or an Illumina NextSeq 500.
Q5 hot start hifi pcr master mix
Manufactured by New England Biolabs
The Q5 Hot Start HiFi PCR master mix is a high-fidelity, hot-start polymerase enzyme designed for accurate and efficient DNA amplification. It provides robust performance and reliable results for a wide range of amplicon sizes.
Automatically generated - may contain errors
3 protocols using q5 hot start hifi pcr master mix
1
High-throughput DNA library preparation
2
Synthesis and Purification of SARS-CoV-2 RNA Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA targets of WT S gene and MT SARS-CoV-2 (covering D614G, N501Y and 69/70 deletion sites) were synthesized (Table S4 ) and then cloned into pUC57 plasmid.
RNA targets were prepared through in vitro transcription with a HiScribe T7 High-Yield RNA Synthesis Kit. Briefly, RNA transcription templates containing a T7 promoter were amplified from pUC57-WT-DNA and pUC57-MT-DNA with specific primers (Table S2 ) using the NEBNext Q5 Hot Start HiFi PCR Master Mix according to manufacturer's instruction, followed by purification using a Gel Extraction Kit. In vitro transcription was performed in 20 μL reaction volume, according to a standard RNA synthesis protocol, at 37 °C for 16 h. Finally, RNA transcripts were treated with DNaseI to remove transcription templates, purified with an RNA Cleanup Kit, and quantified using Thermo Fisher Nanodrop 1000 Spectrophotom.
RNA targets were prepared through in vitro transcription with a HiScribe T7 High-Yield RNA Synthesis Kit. Briefly, RNA transcription templates containing a T7 promoter were amplified from pUC57-WT-DNA and pUC57-MT-DNA with specific primers (
3
Expressing Antibody Variable Regions as Multimers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibody variable regions were cloned into expression plasmids from In vivogen (#pfusess-hchg1, #pfuse2ss-hclk, #pfuse2ss-hcll2). The variable heavy and light chain regions were amplified from the linear expression cassettes (2 µl at 1 ng/µl) using 10 µl NEB Q5 Hot Start HiFi PCR master mix (#M0494S), 6 µl nuclease-free water and 1 µl sequence-specific F and R primer (10 µM, f/c 500 nM) that were based on the results of analysis using IMGT/VQUEST (38 (link)). These primers introduced restriction sites (EcoRI & NheI for hchg1, EcoRI & BsiWII for hclk, and EcoRI & AvrII for hcll2). Annealing temperatures were primer sequence dependent and were calculated using NEB’s Tm calculator to match the salt concentration in their buffer. In an attempt to express the variable regions from IgM+ B cells as a multimer (pentamer/hexamer mix) instead of a monomer, we modified the IgG1 heavy chain expression plasmid (15 (link)). The IgM multimerization sequence PTLYNVSLVMSDTAGTCY (CCAACGCTCTATAATGTCTCTTTGGTTATGTCCGACACAGCCGGTACCTGCTAT) was cloned into the IgG1 expression vector at the C-terminus of the open reading frame, immediately in front of the stop codon, and the leucine at position -139 relative to the proline in the multimerization sequence was changed into a cysteine. Every plasmid was Sanger sequence-verified prior to using it as expression vector.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!