Maraviroc

MDM were infected as described above in the presence or absence of 5 µM Raltegravir. 24 h p.i. 5 µM Maraviroc (Sigma Aldrich) was added to the medium. At 72 h p.i. medium was replaced by fresh medium with 5 µM Maraviroc (Sigma Aldrich) and 5 µM Ral, if needed. 96 hr after infection, medium was removed, and cells were washed twice with PBS before lysis. RNA was extracted using InviTrap Spin Universal RNA Mini Kit (Stratec Biomedical, Birkenfeld, Germany) following manufacturer´s instructions. cDNA synthesis was performed with the SuperScript III Reverse Transcriptase kit (Thermo Fischer Scientific) following manufacturer´s instructions, using 100 ng of RNA. cDNA was used as a template for detecting HIV-1 transcripts with TaqMan quantitative PCR. PCR conditions were as follows: 1X iQ Supermix (BioRad, Hercules, USA), 900 nM primers and 200 nM probe. Cycling conditions were: 98°C for 3 min, 44 cycles of 98°C for 10 s and 60°C for 40 s, followed by 60 cycles with a ramp rate of 0.5°C/cycle for 5 s each starting at 65°C. Primers for detection of gag transcripts used were: Forward, 5´ ACATCAAGCAGCCATGCAAAA 3´, Reverse, 5´ TGGATGCAATCTATCCCATTCTG 3´, Probe, 5´-FAM- AAGAGACCATCAATGAGGAA-TAMRA 3´. Primers and probe binding to eukaryotic 18S rRNA (VIC/MGB, Thermo Fisher 4319413E) were used in parallel as endogenous control for normalization.

Maraviroc was obtained from Sigma-Aldrich (St. Louis, MO, USA) (for in vitro experiments) or GlaxoSmithKline (Brentford, UK) (for in vivo experiments). Mouse CCL3 was obtained from Peprotech (Rocky Hill, NJ, USA). The following antibodies were used as the primary antibodies for immunohistochemical analyses: goat anti-CCR5 antibody (Santa Cruz Biotechnology, Dallas, TX, USA), rat anti-Ly6G antibody (BD Biosciences, San Jose, CA, USA), rat anti-F4/80 antibody (Serotec, Kidlington, UK), mouse anti-α-SMA antibody (Dako, Glostrup, Denmark), rabbit anti-type I collagen antibody, rabbit anti-CD31 antibody and rabbit anti-EGF antibody (Abcam, Cambridge, UK). The following rat anti-mouse antibodies were used as the primary antibodies for the flow cytometric analysis: anti-CD11b antibody (BD Biosciences), anti-CD25 antibody (BioLegend, San Diego, CA, USA), anti-CD45 antibody (eBioscience, San Diego, CA, USA), anti-F4/80 antibody (eBioscience), anti-Foxp3 antibody (eBioscience), anti-Ly6G antibody (Gr-1) (Tonbo Biosciences, San Diego, CA, USA), anti-MIP-1α antibody (R&D Systems, Minneapolis, MN, USA), anti-CCR5 antibody (BioLegend), and isotype-matched control IgGs for individual rat antibodies (BD Biosciences).

The cholangiocarcinoma cells (10⁵–5 × 10⁵ cells) were added into the upper chamber with 100 µl serum free medium, MSC-CM and MSC(TI)-CM alone or combined with Maraviroc (Sigma Chemical Co, MO,USA) (20 µM), MK-2206 (Selleck Chemicals, TX, USA) (10 µM), anti-CCL5 antibody (PeproTech, NJ, USA) (0.5 µg/ml) or PDTC (Selleck Chemicals, TX, USA) (10 µM) were added into the lower chamber (containing 10% FBS). 24 hours later, remove the cell which were not migrated to the the reverse side of the filters and washed with PBS. Then 4% paraformaldehyde fixed the migration cells for 10 minutes, stained with crystal violet staining, and counted in five non-overlapping fields under a bright-field microscopy (IX51, Olympus Corporation, JPN) at 100 magnification.