Steponeplus real time pcr systems thermocycler

Manufactured by Thermo Fisher Scientific

Sourced in United States

The StepOnePlus Real-Time PCR Systems is a thermocycler device designed for real-time PCR applications. It is capable of performing DNA amplification and detection in a single instrument.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Dynamo sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions) Dnase 1 kit, by Thermo Fisher Scientific (1 mentions) Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (1 mentions) Qiaamp viral rna mini kit, by Qiagen (1 mentions)

Close spelling variants of this product

StepOnePlus (2314 citations) StepOnePlus system (1483 citations) Real-Time PCR System (666 citations) StepOnePlus PCR system (278 citations) StepOnePlus thermocycler (235 citations) Thermocycler (175 citations) Real-Time System (23 citations) StepOnePlus Real-Time thermocycler (21 citations) PCR thermocycler (11 citations) Thermocycler PCR system (8 citations)

4 protocols using steponeplus real time pcr systems thermocycler

Isolation and Quantification of Plant RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For total RNA isolation TRIzol reagent (Life Technologies, USA) was used. The isolation was performed according to the producer’s protocol in triplicate. In order to purify the isolated RNA from the remaining DNA, a DNaseI kit (Invitrogen, Germany) was used according to the manufacturer’s protocol. For reverse transcription reaction, that is cDNA synthesis on an RNA matrix, the High Capacity cDNA Reverse Transcription Kit (Life Technologies, USA) was used according to the manufacturer’s instructions.
Real-time PCR was performed in a StepOnePlus Real-Time PCR Systems thermocycler (Applied Biosystems, USA) using the DyNAmo SYBR Green qPCR Kit (Thermo Scientific, USA), according to the manufacturer’s protocol. Primers were prepared to not amplify fungal sequences. Their annealing temperature was 57 °C and their sequences are presented in Additional file 3: Table S1. Real-time PCR reactions were performed in three repetitions for each of the analyzed samples. Changes in gene expression levels were calculated as relative quantities (RQ) of the reference gene (actin) and presented as x-fold of gene expression in relation to non-treated plants.

Wojtasik W., Kulma A., Dymińska L., Hanuza J., Czemplik M, & Szopa J. (2016). Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum. BMC Plant Biology, 16, 75.

+ Open protocol

+ Expand

Fecal FECV RNA Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from fecal swab samples with a QIAamp viral RNA Minikit and from tissue samples with an RNeasy minikit (Qiagen). Alternatively, RNAs observed after the capsid protection assay were used for qRT-PCR. To detect viral genomic RNA, ORF1b-specific primers were designed based on the determined FECV sequence. A 10-µl PCR mixture was used per reaction and contained 2.5 µl of 4× TaqMan Fast Virus 1-Step master mix (Life Technologies, Inc.), 0.9 µl forward primer F1 (5′ AGCGTTGTACTAAGAGCGTTATGGA 3′) of a 10 µM stock solution, 0.9 µl reverse primer R1 (5′ CACATCGACCTTCCTTATACAAAAAG 3′) of a 10 µM stock solution, 0.1 µl of a 10 µM stock solution of the probe (5′ 6-carboxyfluorescein [FAM]-ATGAGCAAGTCTGTTATAAC-MGB-NFQ-3′), 3.6 µl of nuclease-free water, and 2 µl sample RNA or diluted standard RNA. The reverse transcription step (50°C for 5 min) and the enzyme activation step (95°C for 20 s) were followed by 45 cycles (3 s at 95°C and 30 s at 60°C) in a StepOnePlus Real-Time PCR Systems thermocycler (Applied Biosystems).

Ehmann R., Kristen-Burmann C., Bank-Wolf B., König M., Herden C., Hain T., Thiel H.J., Ziebuhr J, & Tekes G. (2018). Reverse Genetics for Type I Feline Coronavirus Field Isolate To Study the Molecular Pathogenesis of Feline Infectious Peritonitis. mBio, 9(4), e01422-18.

+ Open protocol

+ Expand

SYTOX Green Assay for Bacterial Membrane Integrity

Check if the same lab product or an alternative is used in the 5 most similar protocols

To verify the effect of peptides on cell membrane integrity, a SYTOX green uptake assay was used, as previously described. Briefly, E coli and S. aureus cultures in exponential phase of growth were centrifuged at 2000× g for 5 min and washed with PBS 1X to prepare a solution at a concentration of 1 × 10⁶ CFU/mL in PBS 1X. Then, in 100 μL qPCR tubes, 90 µL of the bacterial solution, 5 µL of peptide at 200 µM and 5 µL of SYTOX Green dye at 100 µM were added. The q-PCR tubes were placed in an Applied Biosystems StepOnePlus™ Real-Time PCR Systems thermocycler, programmed with 30 cycles for one minute at 30 °C, using the Syber green filter, recording the fluorescence data at the end of each cycle. Each assay was performed in triplicate.

Aróstica M., Rojas R., Aguilar L.F., Carvajal-Rondanelli P., Albericio F., Guzmán F, & Cárdenas C. (2022). Arginine Homopeptide of 11 Residues as a Model of Cell-Penetrating Peptides in the Interaction with Bacterial Membranes. Membranes, 12(12), 1180.

+ Open protocol

+ Expand

Examining Metastasis Genes in Hs578T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effects of ECM1 downregulation was examined using the TaqMan Human Tumor Metastasis array (Life technologies, Carlsbad, CA) in the Hs578T cell line. Total RNA was extracted after homogenization of cells and tissues using RNeasy mini kit (Qiagen Sciences, Maryland MD). Total RNA (1μg) was reverse transcribed with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City CA). The cDNA reaction was diluted to 1:10 and used as a template for real-time RT-PCR. The cycling conditions were as follows: one cycle of 2 minutes at 50⁰C, one cycle of 10 minutes at 95⁰C, 40 cycles of denaturation (15 seconds at 95⁰ C) and annealing/extension (1 minute at 60⁰ C). All reactions were carried out in the Step One Plus Real-Time PCR Systems Thermocycler (Applied Biosystems, Foster city, CA) in duplicate and repeated at least twice. The ΔCt for mRNA expression was calculated relative to the C_t (threshold cycle) of 18S ribosomal RNA. Relative mRNA expression was calculated using the formula 2 (−ΔΔC_t). The results obtained were analyzed following the manufacturer protocols. The arrays were run in duplicate on cells transfected with NTsiRNA or ECM1 siRNA. Alterations in RNA expression were confirmed by western blotting.

Gómez-Contreras P., Ramiro-Díaz J.M., Sierra A., Stipp C., Domann F.E., Weigel R.J, & Lal G. (2016). Extracellular Matrix 1 (ECM1) regulates the actin cytoskeletal architecture of aggressive breast cancer cells in part via S100A4 and Rho-family GTPases. Clinical & experimental metastasis, 34(1), 37-49.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!