To prepare the samples for imaging after 72 hours, the media was removed, and the cells were washed with 2.0 mL of HBSS. Then, 2.0 mL of the dye (JC-1 2.5 μg mL−1 or MitoSOX 5 μM) in OPTI-MEM were added to the dishes and incubated at 37 °C in the dark for 15 minutes. The cells were washed twice with 2.0 mL of HBSS followed by the addition of 2.0 mL of OPTI-MEM to the dishes. The cells were imaged with a Zeiss LSM 710 multiphoton confocal microscope with the laser power, gain, magnification, and all other parameters held constant. JC-1 and MitoSOX were evaluated as independent experiments.
Lsm 710 multiphoton confocal microscope
The LSM 710 multiphoton confocal microscope is a high-performance imaging system designed for advanced fluorescence microscopy. It combines the capabilities of a confocal microscope with the advantages of multiphoton excitation to provide high-resolution, deep tissue imaging. The LSM 710 is capable of capturing detailed, three-dimensional images of biological samples.
Lab products found in correlation
8 protocols using lsm 710 multiphoton confocal microscope
Mitochondrial Toxicity Assessment via Confocal Microscopy
To prepare the samples for imaging after 72 hours, the media was removed, and the cells were washed with 2.0 mL of HBSS. Then, 2.0 mL of the dye (JC-1 2.5 μg mL−1 or MitoSOX 5 μM) in OPTI-MEM were added to the dishes and incubated at 37 °C in the dark for 15 minutes. The cells were washed twice with 2.0 mL of HBSS followed by the addition of 2.0 mL of OPTI-MEM to the dishes. The cells were imaged with a Zeiss LSM 710 multiphoton confocal microscope with the laser power, gain, magnification, and all other parameters held constant. JC-1 and MitoSOX were evaluated as independent experiments.
Multiphoton Imaging of RhF
Hydrogel Diffusivity Characterization by FRAP
Imaging Lysosome-CpG Interactions in BMDCs
Type B CpG sequence and modifications: 5′ tccatgacgttcctgatgct 3′ coupled to AlexaFluor 547 dye. Packaging of CpG-AF547 was performed as described previously on this manuscript for unlabelled CpG.
Quantifying Misfolded Protein Aggregation
Multiparametric Imaging of 3D Spheroid Apoptosis
Multiphoton and Confocal Microscopy
Quantifying Lipid Droplets in C. elegans
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!