Log In Sign up
The largest database of trusted experimental protocols

Ambion retroscript kit

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Ambion RETROscript kit is a complete system for reverse transcription of RNA to cDNA. It includes reagents for first-strand cDNA synthesis and subsequent PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Isopropyl β d 1 thiogalactopyranoside (iptg), by GoldBio (2 mentions) Antarctic phosphatase, by New England Biolabs (2 mentions) T4 dna ligase, by New England Biolabs (2 mentions) Xhoi, by New England Biolabs (2 mentions) Oligonucleotides, by Eurofins (2 mentions) Lightcycler sybr green master mix, by Roche (2 mentions) Primers for qpcr, by Thermo Fisher Scientific (2 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions) Rneasy plus mini kit, by Qiagen (2 mentions) Evagreen master mix, by Biotium (1 mentions) Jumpstart redtaq readymix, by Merck Group (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Ampicillin sodium salt, by GoldBio (1 mentions) Acyl coa, by Merck Group (1 mentions) Probond nickel chelating resin, by Thermo Fisher Scientific (1 mentions) Kanamycin monosulfate, by GoldBio (1 mentions) N1 acetylspermidine, by Cayman Chemical (1 mentions) Pfuultra high fidelity dna polymerase, by Agilent Technologies (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Quantitect sybr green pcr kit, by Qiagen (1 mentions)

Spelling variants of this product

RETROscript kit (183 citations) Retroscript (29 citations) Ambion RETROscript first strand synthesis kit (2 citations)

9 protocols using ambion retroscript kit

1

Quantitative RT-PCR Analysis of Adipose Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using the total RNA extracted from frozen adipose tissues described above, one μg of RNA was used to make cDNA using the Ambion retroscript kit following manufacturer's instructions (Life Technologies, Grand Island, NY). Primers were designed using the NCBI primer blast and was obtained from Sigma-Aldrich (St. Louis, MO). The sequences of the primers are listed in Supplementary Table 1. For qRT-PCR, three dilution of cDNA (200 ng/μl, 20 ng/μl, and 2 ng/μl) in triplicate was used in the analysis of each gene using the EvaGreen master mix (Biotium, Hayward, CA) with 1 μl of cDNA at the indicated dilutions in a 10 μl reaction following manufacturer's protocol inABI 7900HT qPCR system (Applied Biosystem, Inc., Foster City, CA). The ΔΔCT method was used to quantify the qRT-PCR results and gene products were assayed using agarose gels and dissociation curves. The qRT-PCR data were analyzed using one-way ANOVA with Tukey's post-hoc test.
Fok W.C., Livi C., Bokov A., Yu Z., Chen Y., Richardson A, & Pérez V.I. (2014). Short-term rapamycin treatment in mice has few effects on the transcriptome of white adipose tissue compared to dietary restriction. Mechanisms of ageing and development, 140, 23-29.
+ Open protocol
+ Expand
2

Epidermal RNA Extraction and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols
Skin was collected from newborn mice and epidermis was separated from dermis after heating the skin at 50°C in PBS with 10 mM EDTA. The epidermis was homogenized in Trizol reagent (Life Technologies, Grand Island, NY) using a glass homogenizer and total RNA was prepared according to the manufacturer's recommendations. Reverse transcription was performed using the Ambion RETROscript kit (Life Technologies) according to the manufacturer's instructions. First strand cDNA synthesis was performed using an oligo (dT)18 primer. Subsequent PCR amplification was performed using JumpStart REDtaq ReadyMix (Sigma-Aldrich, St. Louis, MO) with the primer pairs indicated in Table 1.
Madsen D.H., Szabo R., Molinolo A.A, & Bugge T.H. (2014). TMPRSS13 deficiency impairs stratum corneum formation and epidermal barrier acquisition. The Biochemical journal, 461(3), 487-495.
+ Open protocol
+ Expand
3

Synthesis of Sl gasmin dsRNA for RNAi

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA extracted from haemocytes of S. littoralis 6th instar larvae was retro-transcribed (Ambion RETROscript kit, Life Technologies) and a 789 bp long Sl gasmin cDNA fragment was obtained by PCR, using the Sl gasmin dsRNA forward primer (GCCGGCATGTTGTCTATTACC) in combination with the Sl gasmin dsRNA reverse primer (TCCTTCCAGCTTCTGAGTCA). This cDNA fragment was used as template for a nested-PCR reaction, performed with primers containing at their 5’ ends the T7 polymerase promoter sequence (T7-Sl gasmin forward TAATACGACTCACTATAGGGAG-TTCGAGGATACAAGCAGAG; T7-Sl gasmin reverse TAATACGACTCACTATAGGGAG-GGATGCTCAGGATATCTGTTAC). The resulting PCR product was used as template to synthesize Sl gasmin dsRNA (522 bp long), using the Ambion MEGAscript RNAi Kit (Life Technologies), according to the manufacturer’s instructions. Control dsRNA, 500 bp long, was obtained from a control template supplied by the kit used. dsRNA preparations were quantified by measuring their absorbance at 260 nm with a Varioskan Flash Multimode Reader, and purity was evaluated by assessing 260/280 nm absorbance ratios. Products were run on 1% agarose gels to confirm their integrity.
Di Lelio I., Illiano A., Astarita F., Gianfranceschi L., Horner D., Varricchio P., Amoresano A., Pucci P., Pennacchio F, & Caccia S. (2019). Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp. PLoS Genetics, 15(3), e1007998.
+ Open protocol
+ Expand
4

Expression and Purification of AANATL2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Codon optimized AANATL2 was purchased from Genscript. Oligonucleotides were purchased from Eurofins MWG Operon. BL21(DE3) Escherichia coli competent cells and pET-28a(+) vector were purchased from Novagen. Probond™ nickel-chelating resin, Ambion MicroPoly(A) Purist, and Ambion Retroscript kit were purchased from Invitrogen. NdeI, XhoI, Antarctic Phosphatase, and T4 DNA ligase were purchased from New England Biolabs. Ampicillin sodium salt and IPTG were purchased from Gold Biotechnology. Long-chain acyl-CoAs were purchased from Sigma-Aldrich. D. melanogaster (Oregon R) and 4-24 Instant Medium were supplied by Carolina Biological. Silica was purchased from Suppelco. Long-chain N-acylserotonins and N-arachidonoylglycine-d8 standards were purchased from Cayman Chemical. All other reagents were of the highest quality available from either Sigma-Aldrich or Fisher Scientific.
Dempsey D.R., Jeffries K.A., Anderson R.L., Carpenter A.M., Ospina S.R, & Merkler D.J. (2014). Identification of an arylalkylamine N-acyltransferase from Drosophila melanogaster that catalyzes the formation of long-chain N-acylserotonins. FEBS letters, 588(4), 594-599.
+ Open protocol
+ Expand
5

Codon-Optimized AgmNAT Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The AgmNAT gene was codon optimized and synthesized by Genscript. Ambion RETROscript® Kit, ProBond™ nickel-chelating resin, and MicroPoly(A) PuristTM was purchased from Invitrogen. Oligonucleotides were purchased from Eurofins MWG Operon. PfuUltra High-Fidelity DNA polymerase was purchased from Agilent. BL21 (DE3) E.coli cells and pET-28a(+) vector were purchased from Novagen. NdeI, XhoI, Antarctic Phosphatase, and T4 DNA ligase were purchased from New England Biolabs. Kanamycin monosulfate and IPTG were purchased from Gold Biotechnology. Acyl-CoAs were purchased from Sigma-Aldrich. Cayman Chemical commercially synthesized N1-acetylspermidine. All other reagents were of the highest quality and purchased from either Sigma-Aldrich or Fisher Scientific.
Dempsey D.R., Nichols D.A., Battistini M.R., Pemberton O., Ospina S.R., Zhang X., Carpenter A.M., O’Flynn B.G., Leahy J.W., Kanwar A., Lewandowski E.M., Chen Y, & Merkler D.J. (2017). Structural and Mechanistic Analysis of Drosophila melanogaster Agmatine N-Acetyltransferase, an Enzyme that Catalyzes the Formation of N-Acetylagmatine. Scientific Reports, 7, 13432.
+ Open protocol
+ Expand
6

Quantifying Bcl-2 Gene Silencing in Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Silencing of the bcl-2 gene in tumors was measured 24 h after mice were treated by intratumoral injection of 250 μL of the various formulations containing 0.625 mg of the antisense AON/kg. Following treatment, each tumor was excised, weighed, and homogenized using a tissue homogenizer. The mRNA from cells was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA), and cDNA was synthesized using Ambion RETROscript® Kit (Invitrogen, Carlsbad, CA). Using the cDNA, the rt-PCR reaction was conducted to amplify 18S and bcl-2 and detected using QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA). Bcl-2 gene expression in treated mice was normalized to that of untreated animals.
Peddada L.Y., Garbuzenko O.B., Devore D.I., Minko T, & Roth C.M. (2014). Delivery of antisense oligonucleotides using poly(alkylene oxide)-poly(propylacrylic acid) graft copolymers in conjunction with cationic liposomes. Journal of controlled release : official journal of the Controlled Release Society, 194, 103-112.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Stem Cell Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from undifferentiated D3 cells, 12d-old EB formed by D3-eGFP and D3G4 line B cells, and adult mouse heart using the Qiagen RNeasy Plus mini kit with gDNA eliminator columns (Qiagen). Reverse transcription was performed with the Ambion RETROscript Kit (Ambion) on 1–2 μg RNA using random decamers as primers (Ambion) in a final volume of 20 μl. The resulting cDNA was diluted 1:10 for qPCR analysis.
Primers for qPCR (Invitrogen) are listed in Table 1. qPCR was performed using LightCycler SYBRgreen Master Mix (Roche) and a Step One Plus Real-Time PCR System (Applied Biosystems). Cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. All qPCR reactions were performed in triplicate and the results for each cDNA were averaged. Threshold cycle (Ct) values were used to calculate changes in gene expression using the 2−ΔΔCt method [16 (link)]. Results were normalized to Hprt cDNA and fold change was calculated relative to undifferentiated D3 cells. Final qRT-PCR products were visualized on a 2% agarose gel by ethidium bromide staining.
Laemmle L.L., Cohen J.B, & Glorioso J.C. (2016). Constitutive Expression of GATA4 Dramatically Increases the Cardiogenic Potential of D3 Mouse Embryonic Stem Cells. The open biotechnology journal, 10, 248-257.
+ Open protocol
+ Expand
8

qPCR Analysis of Mouse Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol (Invitrogen) and reverse transcribed using the Ambion Retroscript Kit (Ambion) according to the manufacturer’s instructions. Quantitative RT-PCR (qPCRs) were performed with FastStart Universal Probe Master (Roche) and TaqMan assays (see Supplementary Table 3) on an ABI 7500 RealTime PCR System (Applied Biosystems). Assays were performed in technical replicates and normalized to mouse actin as a reference standard.
Banerjee R.R., Cyphert H.A., Walker E.M., Chakravarthy H., Peiris H., Gu X., Liu Y., Conrad E., Goodrich L., Stein R.W, & Kim S.K. (2016). Gestational Diabetes Mellitus From Inactivation of Prolactin Receptor and MafB in Islet β-Cells. Diabetes, 65(8), 2331-2341.
+ Open protocol
+ Expand
9

Quantitative RT-PCR Analysis of Stem Cell Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from undifferentiated D3 cells, 12d-old EB formed by D3-eGFP and D3G4 line B cells, and adult mouse heart using the Qiagen RNeasy Plus mini kit with gDNA eliminator columns (Qiagen). Reverse transcription was performed with the Ambion RETROscript Kit (Ambion) on 1–2 μg RNA using random decamers as primers (Ambion) in a final volume of 20 μl. The resulting cDNA was diluted 1:10 for qPCR analysis.
Primers for qPCR (Invitrogen) are listed in Table 1. qPCR was performed using LightCycler SYBRgreen Master Mix (Roche) and a Step One Plus Real-Time PCR System (Applied Biosystems). Cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. All qPCR reactions were performed in triplicate and the results for each cDNA were averaged. Threshold cycle (Ct) values were used to calculate changes in gene expression using the 2−ΔΔCt method [16 (link)]. Results were normalized to Hprt cDNA and fold change was calculated relative to undifferentiated D3 cells. Final qRT-PCR products were visualized on a 2% agarose gel by ethidium bromide staining.
Laemmle L.L., Cohen J.B, & Glorioso J.C. (2016). Constitutive Expression of GATA4 Dramatically Increases the Cardiogenic Potential of D3 Mouse Embryonic Stem Cells. The open biotechnology journal, 10, 248-257.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!