F12 medium

Trypsin (sequencing grade) was obtained from Promega Corporation (Madison, WI, USA) [7 (link)]. A Micro BCA protein assay kit and Pierce C18 tips were obtained from Thermo Fisher Scientific (Rockford, IL, USA) [7 (link),8 (link)]. Trifluoroacetic acid, dithiothreitol, iodoacetamide, methanol, acetonitrile, formic acid, and all other chemicals were of analytical grade and obtained from Sigma Aldrich Corporation (St. Louis, MO, USA) [7 (link),8 (link)]. All aqueous solutions were prepared using Milli-Q treated water [8 (link)].
The hTERT–EECs, which were established and kept in our lab, were in good condition, maintaining normal cellular characters [8 (link),11 (link)], such as serum dependence, contact inhibition, chromosome number and morphology, and no suspension growth and tumorigenicity [11 (link)]. Epithelial cells were cultured in F-12 medium (Sigma, USA) containing10% Fetal Bovine Serum, 1%Penstrep^® (5000 units/mL penicillin/streptomycin) [8 (link),11 (link)]. Cells were seeded into a 25 cm [2 (link)] ventilation flask and cultured in a water-jacked incubator with 5% CO₂ at 37 °C [11 (link)].

F12 medium, Fetal Bovine Serum (FBS), L-glutamine, penicillin, streptomycin, ATP, A-317491, human TNF-α, and all salts were purchased from Sigma-Aldrich (Toluca, MX). ATP stock solution (100 mM) was made using deionized distiller water and stored frozen; these were diluted to obtain the desired final concentration in external solution prior to use, and the pH was adjusted to 7.4 with NaOH.

Primary line of chicken CEF cells, were prepared from 10-day old pooled chick embryos (males and females) of an inbred White Leghorn strain [62 ] as previously described [63 ]. Cells were maintained at 37 °C and 5% CO2 in a mixture of two parts Dulbecco’s modified Eagle’s medium and one part F-12 medium, supplemented with 8% fetal calf serum, 2% chicken serum, and antibiotic-antimycotic solution (Sigma-Aldrich, St. Louis, MO, USA). Chromosome metaphase spreads obtained from the CEF cell culture (passage 5) were prepared according to Courtet et al. [64 (link)]. Cell suspension was spread onto a clean glass microscopic-slide one day before use for FISH-TSA and stored overnight at −20 °C.

Lung adenocarcinoma cell lines (including A549, H1975, and HCC827), human bronchial epithelial cell lines (including BEAS-2B and NL20), and HEK293T human embryonic kidney cells were obtained from the American Type Culture Collection and tested positive for human origin. The CL-0 and CL1-5 lung adenocarcinoma cell lines were established previously [52 (link)]. All lung cancer cells were grown in RPMI 1640 with 10% fetal bovine serum (Sigma-Aldrich, Burlington, MA, USA) in a 37 °C, 5% CO2 incubator. HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, Burlington, MA, USA) supplemented with 10% fetal bovine serum (Hyclone, Marlborough, MA, USA) in a 37 °C, 5% CO2 incubator. BEAS-2B cells were grown in F12 medium (Sigma-Aldrich, Burlington, MA, USA) with 4% fetal bovine serum, in a 37 °C, 5% CO2 incubator.

SUM149 cells were purchased from Asterand (Detroit, MI) and cultured in F12 medium (Sigma) supplemented with fetal bovine serum (FBS; 5%), penicillin-streptomycin (100 units/mL), insulin (5 μg/mL), and hydrocortisone (1 μg/mL). BT549 cells were purchased from ATCC (Manassas, VA) and cultured in RPMI-1640 medium (Sigma) supplemented with FBS (10%) and penicillin-streptomycin (100 units/mL). Cells were passaged every 3 days and authenticated twice a year at the Characterized Cell Line Core Facility at MD Anderson Cancer Center through genotyping (in August 2014, October 2014, January 2015, November 2018). Stable cell lines were created using an shRNA lentiviral system (Mission shRNA Lentiviral System, Sigma). Briefly, SUM149 and BT549 cells were transduced with shRNA against scrambled control, ERK1 (TRCN0000006150: CCGGCCTGAATTGTATCATCAACATCTCGAGATGTTGATGATACAATTCAGGTTTTT; TRCN0000006151: CCGGCGACCTTAAGATTTGTGATTTCTCGAGAAATCACAAATCTTAAGGTCGTTTTT), and ERK2 (TRCN0000010039: CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTT; TRCN0000010040: CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTT); stably transfected cells were selected in media containing puromycin. Stable SUM149 copGFP-labeled cells were created by infection with the pCMV-copGFP lentiviral vector (System Biosciences) and sorted by flow cytometry-based on GFP expression.