Oligoribonucleotides were synthesized using UltraMILD ribonucleotide phosphoramidites (Link Technologies) with 2′-O-tert-butyldimethylsilyl (TBDMS) protection implemented on an Applied Biosystems 394 synthesizer1 (link). Oligoribonucleotides were cleaved from the support and base deprotected in 25% ethanol/ammonia solution at 20 °C for 3 h, and evaporated to dryness. Removal of TBDMS protecting groups was achieved by redissolving oligoribonucleotides in 115 μL dimethyl sulfoxide to which was added 125 μL 1 M triethylamine trihydrofluoride (Sigma-Aldrich) and incubated at 65 °C for 2.5 h prior to butanol precipitation. All oligonucleotides were purified by gel electrophoresis in 20% polyacrylamide under denaturing conditions (7 M urea) in 90 mM Tris-borate (pH 8.3), 10 mM EDTA (TBE buffer). The full-length RNA product was visualized by brief ultraviolet shadowing. The band was excised and electroeluted using an Elutrap (Whatman) into 45 mM Tris-borate (pH 8.5), 5 mM EDTA buffer, 8 M ammonium chloride at 200 V. The RNA was precipitated with ethanol, washed with 70% ethanol, dried and resuspended in water. Oligoribonucleotides were subjected to further purification by reversed-phase HPLC (ACE C18-AR, Advanced Chromatography Technologies), using an acetonitrile gradient with an aqueous phase of 100 mM triethylammonium acetate (pH 7.0).
Elutrap
Manufactured by Cytiva
The Elutrap is a laboratory instrument designed for the separation and collection of specific molecules or particles from complex mixtures. It utilizes an electric field to facilitate the migration and separation of the desired components. The core function of the Elutrap is to provide a controlled and efficient method for the purification and recovery of target analytes.
Automatically generated - may contain errors
Lab products found in correlation
Sybr gold rna dye, by Thermo Fisher Scientific (2 mentions)
Triethylamine trihydrofluoride, by Merck Group (1 mentions)
Rna loading buffer, by Takara Bio (1 mentions)
Plasmid mega kit, by Qiagen (1 mentions)
Urea, by National Diagnostics (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Vivaspin concentrator, by Sartorius (1 mentions)
Co nh3 6 cl3, by Merck Group (1 mentions)
1 m triethylamine trihydrofluoride, by Merck Group (1 mentions)
Sep pak c18, by Waters Corporation (1 mentions)
Oligonucleotide, by Integrated DNA Technologies (1 mentions)
Oligonucleotide synthesis, by Integrated DNA Technologies (1 mentions)
11 protocols using elutrap
1
Synthesis and Purification of Oligoribonucleotides
2
RNA Transcript Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA template for RNA transcription was prepared by using the Giga-prep kit (Epigentics). The sgRNA was prepared in vitro by mixing rNTPs (rATP, rGTP, rCTP, and cUTP), MgCl2, T7 RNA polymerase (P266L mutant)23 (link), inorganic pyrophosphatase, and the DNA template in the transcription buffer. After 6 hour transcription at 37 °C, the synthesized RNA was precipitated by ethanol treatment overnight, purified using 12% denaturing PAGE (19:1 cross-linking ratio), and electro-eluted (Elutrap, Whatman). The purified RNA was desalted and exchanged into water using Amicon (Millipore).
3
In Vitro Transcription and Purification of meiRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The meiRNA (1–508 nt) was used for in vitro CLIP–seq experiments. The RNA was transcribed and purified in vitro (Lv et al., 2019 (link)). The DNA template used to transcribe the meiRNA was synthesized by TaKaRa Bio Inc. and dissolved in DEPC-treated water to a final concentration of 100 mM. The reaction mixture comprised 10 mM Tris, 10 mM DTT, 10 mM NTPs, 40 mM MgCl2, 0.3 mM T7 template, 0.3 mM DNA templates, and 3 mg/ml T7 polymerase. The reaction was performed at 37°C for 4 h. After transcription, the transcription products were treated with 0.1 total volume (0.1 V) of 0.5 M EDTA, 0.1 V of 5 M NaCl, and 3 V of absolute alcohol and incubated at −40°C overnight. The transcription products were then centrifuged, the supernatant was discarded, and the precipitated RNA was dissolved in 1.5 ml of DEPC-treated water. An equal volume of RNA loading buffer (TaKaRa Bio Inc.) was added, and the mixture was incubated at 90°C for 5 min and cooled on ice for 5 min. The RNA samples were separated on a 12% denaturing polyacrylamide gel and purified using Elutrap (Whatman). The final meiRNA was dialyzed against DEPC-treated water and stored at −80°C.
4
In Vitro Transcription and RNA Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were produced by in vitro transcription. Templates were prepared by polymerase chain reaction (see Appendix Table S2 for oligonucleotides) and GlmZ and GlmZ‐Pro RNA were generated using T7 RNA polymerase at 37°C, followed by treating the reaction mixture with TURBO DNase for 15–20 min at 37°C to eliminate the DNA template. Synthesised GlmZ RNAs were purified on 6% 7.5 M urea polyacrylamide gel (National Diagnostics). The bands were visualised under a portable UV lamp at 254 nm wavelength and excised. Finally, the RNA was purified from the excised gel by overnight electroelution at 4°C and 100 V (EluTrap, Whatman). For all RNAs, purity was checked by 8% urea‐PAGE gel electrophoresis and SYBR gold RNA dye (Thermo Fisher) was used to visualise RNA (Appendix Fig S2d ).
5
In vitro RNA Synthesis and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were prepared by in vitro transcription. Plasmids with the 9S, RprA and GlmZ RNA genes were generously provided by A.J. Carpousis (CNRS, Toulouse), Kai Papenfort (Jena), and Boris Görke (Vienna), respectively. First, genes were amplified by PCR using primers which were also adding T7 promoter. Next, RNA was synthesized from the PCR amplified product using T7 RNA polymerase at 37°C, followed by treating the reaction mixture with TURBO DNase for 15–20 min at 37°C. Finally, the RNA was purified by urea-PAGE followed by electroelution at 4°C and 100V (EluTrap, Whatman) (Bandyra et al. 2018 (link)). In order to generate 5′-monophosphorylated RNA, rGMP was used in addition to rGTP (5:1 molar ratio) while keeping other reaction component and purification steps same as before (Bandyra et al. 2018 (link)). For all RNAs, purity was checked in 8% urea-PAGE gel stained with SYBRgold RNA dye (Thermo Fisher).
6
In Vitro Transcription of Linearized Plasmid DNA
7
In Vitro Transcription of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids carrying 9S and RprA genes were provided by A.J. Carpousis and K. Papenfort, respectively. Forward PCR primers were designed in a way to add promoter sequence recognized by T7 RNA polymerase. PCR products were used as In Vitro Transcription (IVT) templates. IVT was carried out according to standard protocol with addition of 3% DMSO (v/v), followed by DNA template digestion with TURBO DNase (Thermo Fisher). For synthesis of 5′ monophosphorylated RNA, five-fold excess of rAMP or rGMP over rATP or rGTP was used for RprA and 9S respectively to cap the product (Bandyra et al., 2012 (link)). Synthesized RNAs were purified on 4% (9S) or 6% (RprA) polyacrylamide gel containing 7.5 M urea (National Diagnostics). The bands were visualized with UV shadowing and excised, and RNAs were eluted from gel slices by overnight electroelution (100V, EluTrap, Whatman). The ompD RNA was prepared as previously described (Bandyra et al., 2012 (link)).
Primers used for IVT template preparation
| Primer name | Sequence 5′ → 3′ | |
| RprA | For | GTTTTTTTTTTAATACGACTCACTATTACGGTTATAAATCAACACATTG |
| Rev | AAAAAAAAGCCCATCGTAGGAG | |
| 9S | For | GTTTTTAATACGACTCACTATAGAAGCTGTTTTGGCGGATGAGAG |
| Rev | CGAAAGGCCCAGTCTTTCGACTGAGC | |
8
Characterization of CPEB3 Ribozyme Structure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA oligonucleotide templates of the human and chimpanzee CPEB3 ribozymes and their corresponding elongated, precleavage constructs were purchased from Microsynth. Natural abundance, partially deuterated and fully deuterated nucleoside 5′-triphosphates were purchased from GE Healthcare and Cambridge Isotope Laboratories and uniformly 15N-labeled and 13C, 15N-labeled nucleotides from Silantes. The T7 RNA polymerase used for in vitro transcription was produced in house according to standard procedures (Gallo et al. 2005 ). [Co(NH3)6]Cl3 and 8-hydroxyquinoline-5-sulfonic acid were purchased from Sigma Aldrich and 100% D2O was purchased from Armar Chemicals. The electroelution apparatus Elutrap was from Whatman. For desalting, Vivaspin Concentrators (5000 MWCO for the full-length constructs and 2000 MWCO for the auxiliary short ones) from Sartorius-Stedim biotech were used. Thermosensitive shrimp alkaline phosphatase and T4 polynucleotide kinase as well as the appropriate buffers were purchased from Promega.
9
Synthesis and Purification of Ribooligonucleotides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ribooligonucleotides were synthesized using tert-butyldimethylsilyl phosphoramidite chemistry (26 ), as described in Wilson et al. (27 (link)). Oligoribonucleotides were deprotected in 25% ethanol/ammonia solution at 55°C for 2 h, and evaporated to dryness. Oligoribonucleotides were redissolved in 100-µl dimethyl sulfoxide to which 125 µl of 1 M triethylamine trihydrofluoride (Sigma-Aldrich) was added and incubated at 65°C for 2.5 h to remove tert-butyldimethylsilyl-protecting groups. All oligonucleotides were purified by gel electrophoresis in polyacrylamide in the presence of 7 M urea, and the full-length RNA product was visualized by ultraviolet shadowing. The band was excised and electroeluted using an Elutrap (Whatman) into 45 mM Tris borate (pH 8.5) and 5 mM ethylenediaminetetraacetic acid buffer for 8 h at 200 V at 4°C. The RNA was precipitated with ethanol, washed once with 70% ethanol and dissolved in water. The concentration of RNA was determined by measuring the absorbance at 260 nm using an extinction coefficient of 319.4 mM−1 cm−1.
10
Oligonucleotide Purification and Annealing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides listed in Supplementary Table 1 were purchased from Integrated DNA Technologies and gel purified by denaturing 20% PAGE, visualized by UV shadowing to excise the band, and electroeluted from the acrylamide using an Elutrap (Whatman). Oligonucleotides were desalted by loading onto on a C18 SepPak (Waters) which had been pre-equilibrated by washing with acetonitrile, H2O, and 10 mM NH4OAc. SepPaks were washed with H2O, and Oligonucleotides were eluted with 60% methanol and dried in a Speed Vac. After re-suspending samples in 10 mM Hepes pH 7.5, 1 mM EDTA, the concentrations were determined using extinction coefficients at 260 nm. Cy5-labeled Oligonucleotides which were purchased HPLC and were not gel purified. Duplexes were formed by mixing 5 µM of each strand in 10 mM Hepes pH 7.5, 1 mM EDTA, heating to 95 °C for 5 minutes, and slowly cooling to room temperature.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!