Total RNA was extracted from L2-L5 DRGs from control and tumor cell–injected rats with Trizol (Invitrogen). cDNA was synthesized from total RNA using an Omniscript RT kit 50 (QIAGEN, Valencia, CA) following the supplier's instructions. The sequences of the primers for P2X3R, P2X2R, P2X1R, DNMT3a, DNMT3b, TDG, Gadd45a, MBD2, MBD4, and β-actin (as an internal control) used in quantitative polymerase chain reaction are shown in Table 1 . Control reactions were performed in the absence of cDNA templates. The Ct value was defined as the cycle number at which fluorescence intensity reached a certain threshold where amplification of each target gene was within the linear region of the reaction amplification curves. The relative expression level for each target gene was normalized by the Ct value of β-actin using a 2ΔΔCt relative quantification method.
Omniscript rt kit 50
Manufactured by Qiagen
Sourced in Germany
The Omniscript RT kit 50 is a reverse transcription kit designed for the conversion of RNA to cDNA. It contains all the necessary components for the reverse transcription reaction, including the Omniscript Reverse Transcriptase enzyme, buffers, and dNTPs.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using omniscript rt kit 50
1
Quantitative Analysis of DRG Genes
2
Quantitative RT-PCR Analysis of CXCL12 and CXCR4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from T9-T13 DRGs from control and TNBS-injected rats with Trizol (Invitrogen). cDNA was synthesized from total RNA using an Omniscript RT kit 50 (QIAGEN) following the supplier’s instructions. The sequences of the primers for CXCL12, CXCR4, and β-actin (as an internal control) used in quantitative polymerase chain reaction were as follows: CXCL12 forward: CGATTCTTTGAGAGCCATGTC, CXCL12 reverse: TTAAGGCTTTGTCCAGGTACTCT; CXCR4 forward: CTCTGAGGCGTTTGGTGCT, CXCR4 reverse: TGCCCACTATGCCAGTCAAG, β-actin forward: TCAGGTCATCACTATCGGCA, β-actin reverse: GGCATAGAGGTCTTTACGGAT. Control reaction was carried out in the absence of cDNA templates. The Ct value was defined as the cycle number at which fluorescence intensity reached a certain threshold where amplification of each target gene was within the linear region of the reaction amplification curves. The relative expression level for each target gene was normalized by Ct value of β-actin using a 2ΔΔCt relative quantification method as described previously.24 (link)
3
Extraction and Quantification of miR-200a-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 0.5 mL serum sample was added with TRIzol reagent (YT2188, Yitabio, Beijing, China), placed at room temperature for 5 min, added with 0.2 mL chloroform, mixed well, placed at room temperature for 15 min, and centrifuged at 12,000 g for 5 min and the supernatant was transferred to another centrifuge tube. Subsequently, the total RNA was purified using RNA purification kit (DP412, Tiangenbio, Beijing, China) according to the manufacturer’s instructions. The concentration and purification of extracted RNA was determined using an ultraviolet spectrophotometer and cDNA was synthetized using Omniscript RT Kit (50) (Qiagen205111, QIAGEN, Duesseldorf, Germany). The RT-qPCR was performed using ChamQTM SYBR qRT-PCR MasterMix (Vazyme biotech, Nanjing, Jiangsu, China). The reaction system was as follows: pre-denaturation at 95 °C for 10 min and 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s and extending at 72 °C for 10 s. The relative expression of miR-200a-3p standardized by the internal reference U6 was calculated using the 2−ΔΔCt method. The primer sequences are shown in Table 1 .
Real-time PCR primer sequence
| Gene | Forward 5’-3’ | Reverse 5’-3’ |
|---|---|---|
| miR-200a-3p | CGCGTGTAGCAATGGTCTGT | AGTGCAGGGTCCGAGGTATT |
| U6 | CTCGCATCGGCAGCACA | AACGCTACTCGAATTGCGT |
4
Quantitative Analysis of Nociceptive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the L4-L6 DRGs and SDH using Trizol (Invitrogen, CA) method. cDNA was synthesized from total RNA using an Omniscript RT kit 50 (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The primers for TRPV1, ASIC3, and GAPDH (internal control) were used. The primer sequences are showed in Table 1 . To evaluate the expressions of genes, 2-△△Ct values were calculated. The mRNA expression values of TRPV1 and ASIC3 were normalized to that of GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!