Total RNA was extracted from eluted mRNA samples or the siRNA-transfected HFF-1or MAGI cells by using the RNeasy kit (Qiagen), and 1 µg of RNA was reversely transcribed by using the iScript™ cDNA Synthesis Kit (Catalog No. 1708890, Bio-Rad, Hercules, CA). Real-time PCR assay was performed by using the SYBR Premix (Catalog No. 4106212, Bio-Rad). The primers of different genes for qPCR are listed in Table S1 . The PCR reactions were run on an Bio-Rad CFX connect qPCR machine under the following conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Relative fold of gene expression was normalized to the GAPDH or BC-Input control. Fold change of gene expression was calculated using the formula: 2(ΔCT of gene−ΔCT of GAPDH) or 2(ΔCT of gene−ΔCT of BC-Input).
Cfx connect qpcr machine
Manufactured by Bio-Rad
Sourced in United States
The CFX Connect qPCR machine is a real-time PCR system designed for quantitative gene expression analysis. It provides precise detection and quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Rneasy kit, by Qiagen (3 mentions)
Sybr premix ex taq 2, by Bio-Rad (2 mentions)
Sybr premix, by Bio-Rad (1 mentions)
Sybradvanced 2x, by Bio-Rad (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Itaq universal sybr green supermix 2x, by Bio-Rad (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Zymobiomics dna miniprep kit, by Zymo Research (1 mentions)
Bead ruptor, by Omni International (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Iscript reverse transcription supermix, by Bio-Rad (1 mentions)
Sybr green, by Bio-Rad (1 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
Cfx manager software, by Bio-Rad (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Superase in rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
16 protocols using cfx connect qpcr machine
1
Quantifying Gene Expression via qPCR
2
Quantifying Bacterial Abundance with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantification of the abundance of bacteria was performed with real-time qPCR using the universal primers 515f (5′-GTGCCAGCMGCCGCGGTAA) and 806r (5′-GGACTACHVGGGTWTCTAAT) (http://earthmicrobiome.org/emp-standard-protocols/16s/ ) to target the bacterial 16S rRNA gene using a CFX Connect qPCR machine (Bio-Rad, Hercules, USA), with SYBRAdvanced 2X (Bio-Rad) SYBR green supermix and 2 μL of DNA. All samples were quantified in triplicate. Serial dilutions of plasmids containing inserts of E. coli 16S rRNA were performed to establish standard curves [82 (link)]. Only reactions that had a R2 from 90 to 110% were considered satisfactory. In order to search for significant differences in bacterial quantification (qPCR) between samples, Analysis of variance (ANOVA) and Wilcoxon tests were applied through Dplyr package [89 ] in R software [90 ]. We used ggplot2 [91 ] to visualize all qPCR results.
3
Quantifying Gene Expression with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred fifty nanograms of RNA was used to convert to cDNA using the Applied Biosystems High‐Capacity cDNA Reverse Transcription Kit following the manufacturer's instructions (Cat # 4368814). The cDNA thus obtained was diluted at 1:10, 1:100, and 1:1000. The housekeeping gene, 18 s, was run at all three dilutions to ensure the quality of the cDNA. Five microlitres of the 1:100 cDNA reaction was used to perform qPCR on the gene of interest. For each qPCR reaction, the 5 μL cDNA was added to 10 μL of iTaq Universal SYBR Green Supermix (2X) (Biorad Cat #1725120), 1.5 μL of each primer (375 nM concentration), and 2 μL of nuclease free water. Thus, a total volume of 20 μL of qPCR mix was run on the BioRad CFX connect qPCR machine. The qPCR data for each gene were analysed using the double delta Ct method.
4
RT-qPCR Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR assays were performed following the previously published protocol (64 (link)). Total RNAs from harvested cells were extracted using the NucleoSpin RNA extraction kit (Cat. # 740955.250, MACHEREY-NAGEL), and 0.4–1 μg RNA was reversely transcribed using the iScript™ cDNA Synthesis Kit (Cat. # 1708890, Bio-Rad). Real-time qPCR was conducted using the iTaq™ Universal SYBR® GreenSupermix (Cat. # 1727125, Bio-Rad). The PCR reaction was performed on a Bio-Rad CFX connect qPCR machine under the following conditions: 95 °C for 10 m, 50 cycles of 95 °C for 15 s, and 60 °C for 1 m. Relative gene expression was normalized to GAPDH internal control as the 2−ΔΔCt method: 2 (ΔCT of targeted gene - ΔCT of GAPDH). The following primers were used. IL-4 forward: 5’-GTTCTACAGCCACCATGAGAA-3’, reverse: 5’-CCGTTTCAGGAATCAGATCA-3’; IL-6 forward: 5’-ACTCACCTCTTCAGAACGAATTG-3’, reverse: 5’-CCATCTTTGGAAGGTTCAGGTTG-3’(30 ); IL-8 forward: 5’-CTTGGCAGCCTTCCTGATTT-3’; reverse: 5’-GGGTGGAAAGGTTTGGAGTATG-3’; Nsp14 forward: 5’-CGGAAACCCAAAGGCTATCA-3’, reverse: 5’-TGTGGGTAGCGTAAGAGTAGAA-3’; IMPDH2 forward: 5′-CTCCCTGGGTACATCGACTT-3′, reverse: 5′-GCCTCTGTGACTGTGTCCAT-3′(64 (link)); GAPDH forward: 5′-GCCTCTTGTCTCTTAGATTTGGTC-3′, reverse: 5′-TAGCACTCACCATGTAGTTGAGGT-3′. SARS-CoV-2-TRS-L (N sgRNA forward): CTCTTGTAGATCTGTTCTCTAAACGAAC, SARS-CoV-2-TRS-N (N sgRNA reverse):GGTCCACCAAACGTAATGCG(65 (link))
5
Quantifying S. aureus Bacterial Load
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples from the S. aureus binding/internalization assays were spun down at 7,000 rpm for 10 min, and the same gDNA isolation protocol was followed as described above. The standard curve and samples each were added to the same reaction mixture: 5 µL SYBR, 3 µL DEPC water, 1 µL femA primer set, and 1 µL of diluted gDNA. The plate was then sealed with an adhesive lid and placed in a BioRad CFX Connect qPCR machine. Each sample was compared back to the standard curve to determine the total quantity of bacteria.
6
Quantification of Bacterial DNA by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One colony of bacteria was inoculated into 5 mL of TSB and incubated at 37°C for 18 h. A 1:10 dilution of this overnight culture was added to TSB and placed in an incubating orbital shaker until desired growth was reached by OD600 readings (number of bacteria in the culture was determined from previous growth curve experiments performed). 5E8 bacteria were isolated from culture and spun down at 4,000 × g for 10 min. The supernatant was removed and the bacteria were resuspended in 500 µL of DNA/RNA shield. Samples were placed on a bead ruptor (Omni International) at medium speed for 60 s, and this was repeated a total of three times. The ZymoBIOMICS DNA Miniprep kit (Cat. #D4304, Zymo Research) was then used with the vendor-supplied protocol. In the final step, gDNA was eluted in 50 µL DEPC water. To generate the standard curve, isolated gDNA copies (107, 106, 105, 104, 103, and 102) were used. Each well received 5 µL SYBR, 3 µL DEPC water, 1 µL femA primer set (F: 5′-AACTGTTGGCCACTATGAGT -3′, R: 5′-CCAGCATTACCTGTAATCTCG -3′), and 1 µL of diluted gDNA. The plate was then sealed with an adhesive lid and placed in a BioRad CFX Connect qPCR machine and run with the following protocol: initial denaturation of 94°C for 10 min, followed by 39 cycles of 15 s at 94°C and then 1 min at 55°C.
7
Genomic DNA and RNA Extraction with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of genomic DNA was performed by using the DNeasy Blood & Tissue Kit (Qiagen, cat. # 69504) according to the manufacturer’s instruction. Total RNAs were extracted from the assayed cells by using the RNeasy kit (Qiagen), and 0.2–1 μg of RNA was reversely transcribed using the iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCR assay was conducted using the SYBR Premix ExTaq II (Bio-Rad) and gene-specific primers (S1 Table ). The PCR reactions were performed on a Bio-Rad CFX connect qPCR machine under the following conditions: 95 °C for 10 mins, 40 cycles of 95 °C for 15 secs and 60 °C for 1 min. Relative percentage of gene expression was normalized to GAPDH control, and was calculated using the formula: 2(Δ C T of gene−Δ CT of GAPDH).
8
Real-Time qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In a 96-well plate, each well received 4 µL of cDNA mix (0.4 µL of cDNA and 3.6 µL of DEPC water) and 6 µL of primer mix [5 µL SYBR (Cat #95053-02K, Quantabio) and 1 µL primer (10 µM stock)]. The plate was then sealed with an adhesive lid, placed in a Bio-Rad CFX Connect qPCR machine, and run with the following protocol: initial denaturation of 94°C for 3 min, followed by 39 cycles of 15 s at 94°C and then 1 min at 55°C. Primers for genes of interest were ordered through Integrated DNA Technologies (Table 1 ). Human GAPDH was used as a housekeeping gene.
9
Quantitative gene expression analysis
10
Quantitative RT-PCR Analysis of T Cell Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of gene transcripts, mRNA was isolated from purified naive or activated T cells using Qiagen RNeasy Mini Kits following the manufacturer’s instructions. cDNA was generated using iScript Reverse Transcription Super mix (Bio-Rad) following the manufacturer’s instructions. A total of 20 μg of cDNA was mixed with a final concentration of 0.5 μM of the forward and reverse primers and the recommended amount of Sybr Green (Bio-Rad) reagents. The mixture was added to a Bio-Rad CFX Connect qPCR machine and run at 95°C for 3 minutes to start, then 40 cycles of 95°C for 10 seconds, and 55°C for 30 seconds. The results were analyzed using the ΔΔCt method. The primers used are listed in Supplemental Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!