Firescript rt kit

RNA was extracted from frozen kidney tissue by trizol and chloroform separation with genomic DNA removal by DNA-free DNA removal kit (Thermo Fisher). cDNA was generated by FireScript RT kit (Solis Biodyne) as per manufacturer’s instructions. RT-PCR was performed with validated primers for Gapdh (housekeeping control) (24 (link)), Il1b (25 (link)), Tnfa (Fwd 5’ CCCTCACACTCAGATCATCTTCT 3’, Rev 5’ GCTACGACGTGGGCTACAG 3’), Ccl2 (26 (link)), Cxcl1 (27 (link)) and PowerUp SYBR Green Master Mix (Applied Biosystems) for 40 cycles under single-plex conditions (QuantStudio 6, Life Technologies). cDNA-specific amplification was ensured by inclusion of reverse transcriptase-negative and template-negative controls. Samples were run in triplicate and cycle threshold values were determined by automatic threshold analysis (QuantStudio Software), with the 2^-ΔΔCt method used to calculated relative gene expression from the average threshold of each sample, relative to the average of the C57BL/6 group.

Extracted RNA of ERα was reverse transcribed using a gene-specific primer set described by Sakimura et al. [2 ] (Table-1). The reaction was performed using the FireScript® RT Kit (Solis BioDyne, Estonia) according to the FireScript Kit datasheet protocol [16 ]. The resulting cDNA was stored at −20°C until future RT polymerase chain reaction (PCR) analysis was conducted.

RNA from lung tissue was obtained by Trizol/Chloroform extraction and converted to complementary DNA (cDNA) using the FireScript RT kit (Solis Biodyne) as per manufacturer's instructions. RT‐PCR used validated primers for Csf3⁴⁵ and 18S⁴⁶ with PowerUp SYBR Green Master Mix (Applied Biosystems) as per manufacturer's instructions for 40 cycles under single‐plex conditions (QuantStudio 7; Life Technologies). RT‐negative and template‐negative controls were included to validate cDNA‐specific amplification. Samples were run in triplicate and cycle threshold values were determined by automatic threshold analysis (QuantStudio Software), from which the triplicate average was used to determine relative gene expression using the 2^−ΔΔCt method, with 18S as the housekeeping control.