Protein a g sepharose

Cell lysates were prepared with radio immunoprecipitation assay buffer containing protease inhibitors (Beyotime) and clarified by centrifugation at 10 000 x g for 15 min at 4 °C. Equal amounts as determined using the Bio‐Rad RC/DC protein assay were electrophoresed by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Membranes were blocked with 4% skim milk and incubated with primary antibodies overnight at 4 °C, decorated with horseradish peroxidase‐conjugated secondary antibodies (Table S5, Supporting Information) with detection using chemiluminescence (Advansta). Alternatively, for immunoprecipitations, cell lysates prepared with IP buffer (0.5% NP‐40, 20 × 10⁻³m Tris pH 7.4, 150 × 10⁻³m NaCl, 1.5 × 10⁻³m MgCl₂ and protease inhibitor cocktail (Solarbio)) were incubated with primary antibodies adsorbed to protein A/G‐sepharose (Invitrogen) beads for 4 h, washed five times with IP buffer. Antibody sources/dilutions are shown in Table S4 with uncropped immunoblot scans provided in the Supporting Information.

Cells were lysed in NP40 lysis buffer containing protease-inhibitor cocktail (Roche, Indianapolis, IN) and 800 μg proteins were pre-cleared with protein-A/G sepharose (Invitrogen) for 1 h at 4 °C and immunoprecipitated with 4 μg of antibody or immunoglobulin G (IgG) as a negative control for overnight at 4 °C. The immune complexes were recovered with protein-A/G sepharose for 2 h and then washed with NP40 lysis buffer at least three times. The precipitates were boiled with sample buffer for 5 min and proceeded for western blot.

Cells were fixed in 1% formaldehyde for 10 min at room temperature. The crosslinking reaction was quenched with 0.125 M glycine. After washing with PBS, cells were lysed with lysis buffer (50 mM Tris·HCl pH 8.0, 2 mM EDTA, 15 mM NaCl, 1% SDS, 0.5% deoxycholate, protease inhibitor cocktail, 1 mM PMSF), followed by sonication and centrifugation. The supernatant was collected and precleared in dilution buffer (50 mM Tris-HCl pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100) with protein A/G Sepharose and pre-treated salmon DNA. The precleared samples were incubated overnight with H3K9ac antibody (2 μg/sample, Millipore) or appropriate control IgGs (Santa Cruz), and protein A/G Sepharose (Invitrogen). After washing sequentially with a series of buffers, the beads were heated at 65°C to reverse the crosslink. DNA fragments were purified and analyzed. Real-time PCR was performed with primers as described (Zhong et al., 2010 (link)):
LDHB-ChIP-5’: AGAGAGAGCGCTTCGCATAGLDHB-ChIP-3’: GGCTGGATGAGACAAAGAGCALDOC-ChIP-5’: AAGTGGGGCACTGTTAGGTGALDOC-ChIP-3’: GTTGGGGATTAAGCCTGGTTPFKM-ChIP-5’: TTAAGACAAAGCCTGGCACAPFKM-ChIP-3’: CAACCACAGCAATTGACCACLDHA-ChIP-5’: AGGGGGTGTGTGAAAACAAGLDHA-ChIP-3’: ATGGCTTGCCAGCTTACATCLDHA-ChIP-1Kb-5’: TGCAAGACAAGTGTCCCTGTLDHA-ChIP-1Kb-3’: GAGGGAATGAAGCTCACAGC

co-IP was performed as described previously [17 (link)]. Briefly, the cell lysate was incubated with protein A/G-Sepharose (Novex, Oslo, Norway) and 3 μl antibodies, shook overnight at 4°C, washed with western/IP lysis buffer, and centrifuged at 3500 rpm for 1 minute at room temperature three times. The remaining steps were similar to western blotting. The antibodies used for IP were anti-CREB (CST, #9104), anti-CREB (CST, #9197), anti-ILF2 (Abcam, #ab154169), anti-FLAG (CST, #8146), and anti-HA (CST, #2367). For in vitro reciprocal co-IP, the reagents used were purified protein CREB (Abnova, Taiwan, #H00001385-P01), protein ILF2 (Abnova, #H00003608-P01), and DTT (Beyotime, #ST041) and the method has been described before [18 (link), 19 (link)].

Co-IP was performed as described previously30 (link). The reagents used were protein A/G-Sepharose (Novex, Oslo, Norway) and Western/IP lysis buffer (Beyotime, Haimen, China). The antibodies used for IP were anti-YAP (Santa Cruz Biotechnology, #sc101199) or anti-FLAG (CST, #8146).