Hsp3901

Lysis plates were created by dispensing 0.4 μL lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher, R0193), 3.125 μM Oligo-dT₃₀VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT₃₀VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). All plates were then spun down for 1 minute at 3220xg and snap frozen on dry ice. Plates were stored at −80°C until used for sorting.

Lysis plates were prepared by dispensing 0.3 μL lysis buffer (4 U recombinant RNase inhibitor [RRI; Takara Bio, 2313B], 0.12% TritonX-100 [Sigma, 93443-100ML] in dH₂O, 1 μM Smart-seq-total oligo-dT primer (5′-Biotin-/5BiosG/CATAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGT₃₀VN-3′; IDT) in TE buffer (IDTE [10 mM Tris, 0.1 mM EDTA], IDT) (see SI Appendix, Table S2 for a full list of oligos used in the present study) into 384-well hard-shell PCR plates (Bio-Rad HSP3901) using Mantis liquid handler (Formulatrix). For the comparison with Smart-seq2 (see Comparison of Smart-seq2 and Smart-seq-total, below), 96-well lysis plates were prepared with 3 μL lysis buffer. All plates were sealed with AlumaSeal CS Films (Sigma-Aldrich, Z722634), spun down, and snap-frozen on dry ice.
Cells were stained with calcein-AM and ethidium homodimer-1 (LIVE/DEAD Viability/Cytotoxicity Kit, ThermoFisher, L3224) following the manufacturer’s protocol and individual live cells were sorted in 384-well lysis plates using SONY sorter (SH800S) with a 100-μm nozzle chip. Plates were spun down and stored at −80 °C immediately after sorting.