The largest database of trusted experimental protocols

Silencer pre designed sirna

Manufactured by Thermo Fisher Scientific
Sourced in United States

Silencer Pre-designed siRNA is a laboratory product designed to enable RNA interference (RNAi) experiments. It consists of ready-to-use small interfering RNA (siRNA) sequences that target specific genes, allowing for the study of gene function and regulation.

Automatically generated - may contain errors

44 protocols using silencer pre designed sirna

1

Knockdown of CD105 and CD90 in MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
UCT MSCs from their 3rd passage in culture were plated in 6-well plates at a density of 2 × 105 cells/well in growth medium and allowed to attach overnight. The cells were then transfected with pool siRNAs to CD105 (Silencer Pre-designed siRNA, Assay ID 145526 and Assay ID 7906, cat # AM16708, ThermoFisher Scientific) or CD90 (Silencer Pre-designed siRNA, Assay ID s14125, cat # 4392420, ThermoFisher Scientific). Control wells were transfected with a Silencer negative control siRNA (cat # AM4613, Thermo Fisher Scientific). Transfection was performed using Fugene 6 Transfection reagent (cat # 11814443001, Roche) as per manufacturer’s instructions. Lipid-siRNA complexes were incubated in Opti-MEM Reduced Serum Medium (cat # 31985070, ThermoFisher Scientific) for half an hour and was then added to MSCs in growth medium. After 48 h, myogenic differentiation was induced by replacing transfection medium with M1 medium. At least 3 biological replicates were performed for each knockdown assay.
+ Open protocol
+ Expand
2

Silencing CPS1 and CPS1-IT1 in ICC-9810 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CPS1-specific siRNA (Silencer™ Predesigned siRNA; sense GCA GCA UUG ACC UAG UGA UTT and antisense AUC ACU AGG UCA AUG CUC GCTT), CPS1-IT1-specific siRNA (Silencer™ Predesigned siRNA; sense CGA GUU CUA AAG UCC GAUATT and antisense UAU CGG ACU UUA GAA CUCGTT) and negative control siRNA (Silencer™ Negative Control siRNA) were purchased from Life Technologies (Grand Island, NY, USA). The ICC-9810 cells were assigned to the following treatment groups: A siCPS1 group, a siCPS1-IT1 group, a siCPS1 + siCPS1-IT1 group, and a negative control siRNA group. The ICC-9810 cells were cultured overnight until they were 80% adherent. siRNA oligomers were diluted with Opti-MEM® I Reduced Serum medium (Invitrogen Life Technologies, Carlsbad, CA, USA) and incubated for 5 min at room temperature. The siRNA oligomers (final concentration, 20 nmol) were mixed with the Lipofectamine® 2000 (7.5 ml/well; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and incubated for 20 min at room temperature to allow siRNA-Lipofectamine® 2000 complexes to form. The siRNA-Lipofectamine® 2000 complexes were added to each well at a final concentration of 50 pmolml. The cells were incubated in a humidified atmosphere (37°C and 5% CO2) and the RPMI-1640 medium supplemented with 10% FBS was replaced following 4 h.
+ Open protocol
+ Expand
3

Nup98 Silencing in MCF7 and PC3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF7 cells were a gift from S. Merajver’s laboratory (University of Michigan). PC3 cells were a stable cell line expressing cell cycle reporters hCdt1-mCherry and p27K-mVenus previously described (Takahashi et al., 2019 (link)). The cells were grown to 50-70% confluency in a 12-well plate or eight-well chamber slide. The cells were then transfected with 20 nM Nup98 siRNA or control siRNA using Lipofectamine RNAi MAX (Invitrogen), following the manufacturer's protocol. The cells were incubated with the indicated siRNA for 72 h, then harvested for fixation and staining or lysed for western blotting. siRNAs used were as follows: Silencer Select Negative Control No. 1 (4390843, ThermoFisher Scientific); Nup98-96 siRNA#1, Silencer Pre-designed siRNA (AM16708, ThermoFisher Scientific); Nup98-96 siRNA#2, Silencer Select Pre-designed siRNA (4392420, ThermoFisher Scientific); Nup98-96 siRNA#3, Nup98 siRNA (sc-43436, Santa Cruz Biotechnology). Cell lines were tested for mycoplasma routinely and were negative in June 2021. PC3 cells were authenticated prior to publication (Takahashi et al., 2019 (link)).
+ Open protocol
+ Expand
4

Overexpression of miR-212-3p in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MirVana™ miR-212-3p Mimic (Catalog: 4464066; Assay ID: MC10340) and scramble negative control (Catalog: 4464059) were purchased from ThermoFisher Scientific. Silencing RNA for NFIB and EZH2 (Silencer™ Pre-Designed siRNA (Catalog: 4392420); Assay ID: s9495 and s4918, respectively) were obtained from ThermoFisher Scientific. Tet-On-miR-212-3p lentiviral vector and Tet3G (3rd generation) expression lentiviral vector (Vector ID:VB180123-1018bxq) were purchased from Vector Builder Inc. Detailed reagent sections can be found in the Additional file 1.
+ Open protocol
+ Expand
5

Modulating Immune Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
STING was stimulated with 10 μg/mL cGAMP (InvivoGen, San Diego, CA, USA). Toll-like receptor 3 (TLR3) was stimulated with 10 ng/mL naked p(I:C) and Toll-like receptor 4 (TLR4) with 100 ng/mL LPS (Merck, Rahway, NJ, USA). As negative control, we used ssRNA (InvivoGen). STING was inhibited with the irreversible STING inhibitor H-151 (0.5 μM, InvivoGen) [27 (link)]. NFκB was inhibited with 5 μM BAY 11-7082 (Cayman Chemical Company, Ann Arbor, MI, USA). Irf3 expression was suppressed via siRNA silencing, using oligos from Thermo Fisher (Waltham, MA, USA) (Silencer™ Pre-Designed siRNA, Cat. No.: AM16708, siRNA ID: 184585). Autophagy was stimulated with serum deprivation. Autophagy was inhibited with 100 μM chloroquine treatment, as described in [28 (link)].
+ Open protocol
+ Expand
6

Silencing MAN1C1 in Corneal Epithelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MAN1C1 was silenced using a Silencer Pre-designed siRNA (ID133094; Thermo Fisher Scientific). Silencer Negative Control siRNA having no significant similarity to any known gene sequences from mouse, rat, or human was used as a negative control. Preconfluent cultures of human corneal epithelial cells were transfected by a 6-h incubation with 500 nM siRNA in Lipofectamine 2000 (1 μl/100 mm2, Life Technologies) dissolved in Opti-MEM reduced-serum medium (Life Technologies) as described [15]. After transfection, the cells were incubated in KSFM for an additional 3 d before treatment with recombinant human galectin-3 (100 µg/ml) or bovine serum albumin control (100 µg/ml) for 24 h.
+ Open protocol
+ Expand
7

Silencing Small GTPases and Motors in BECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
RAB27b (Silencer® Pre-Designed siRNA, Thermo Fisher), MyRIP (Silencer® PreDesigned siRNA, Thermo Fisher), MyosinVIIa (SMARTpool, Dharmacon Inc.), Myosin Va (SMARTpool, Dharmacon Inc.), Rab11FIP1 to 5 (FlexiTube siRNA, Qiagen) were knocked down by siRNA targeting four non-overlapping regions, and the siRNAs were transfected into BECs using Lipofectamine 2000 (Invitrogen). To knockdown other components, shRNA targeting RAB11a (UGGUUUGUCAUUCAUUGAAAC), Sec6 (GGCCUCCGUGGAGGCCAGA), Sec15 (CCAAAUGCGCACAAGAAGUU) or DYNC1L1 (GCACUUAUUUACACUUCAGUA) was inserted into pLKO.1 vector and transfected in human BECs
+ Open protocol
+ Expand
8

siRNA Targeting ErbB3 in miPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For siRNA experiment, silencer predesigned siRNA targeting ErbB3 was purchased from (Thermo Fisher Scientific, USA). The oligonucleotide sequences of the siRNA were; sense 5′ CGAGAAUAUUCGCCCAACCtt 3′, antisense 5′ GGUUGGGCGAAUAUUCUCGtc 3′. The Negative control siRNA was from (Qiagen, USA). The miPSCs were transfected with Lipofectamine RNAiMAX (Thermo Fisher Scientific, USA) according to the manufacturer's instructions and cells were collected and subjected to western blotting.
+ Open protocol
+ Expand
9

CALM1 Gene Silencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Silencer® Pre-designed siRNA against CALM1 gene (siRNA ID 146695, catalog number AM51331) and scrambled sequence siRNA (Silencer® Negative Control #1 siRNA, catalog number AM4611) were obtained from ThermoFisher.
+ Open protocol
+ Expand
10

siRNA Transfection of Target Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
5 nmol of Silencer™ Pre-Designed siRNA (siRNA ID: 14402, ThermoFisher, Waltham, MA) specific to CAMP were diluted first in 50 uL nuclease-free H2O. 3.3 μL of this stock were mixed with 30 μL Optimem media (Gibco, Waltham, MA) and further diluted in an additional 450 μL Optimem. 27 μL Lipofectamine reagent (Invitrogen, Carlsbad, CA) was then mixed with 450 μL Optimem and the resulting mixture was added to the 459 μL of diluted siRNA mix. 300 μL of the resulting transfection master mix was added to every 2 mL of media containing target cells, or 15 μL into 100 μL of a 96 well plate.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!