To detect the expression of miR-182 in 23 pairs of samples, RT-qPCR was carried out on an Applied Biosystems PCR 7900 system. Total RNA was extracted and normalized as previously reported [24 (link)–28 (link)]. The expression levels of miR-182 were evaluated with a mirVana RT-qPCR miRNA Detection Kit (Ambion Inc., Austin, TX, USA). The combination of miR-103 and miR-191 was considered an endogenous control and served as a reference in our previous study [29 (link)]. TaqMan MicroRNA Assays from Applied Biosystems were used in the PCR system, and the sequences were as follows: miR-182 (Cat. No. 4427975-002334): UUUGGCAAUGGUAGAACUCACACU; miR-103 (Cat. No. 4427975-000439): AGCAGCAUUGUACAGGGCUAUGA; and miR-191 (Cat. No. 4427975-000490): CAACGGAAUCCCAAAAGCAGCU. The expression of miR-182 in the FFPE experiments was computed with the formula 2-Δcq.
Pcr 7900 system
Manufactured by Thermo Fisher Scientific
The PCR 7900 system is a real-time PCR instrument designed for high-throughput nucleic acid amplification and detection. It features a 96-well format and is capable of performing quantitative PCR (qPCR) experiments. The system is equipped with an optical detection system that enables the simultaneous measurement of multiple fluorescent reporter dyes.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using pcr 7900 system
1
Quantifying miR-182 Expression in FFPE Samples
2
LUAD Cell Line Transfection with miR-183-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three human NSCLC cell lines: H460, A-549 and H1299 were acquired from American Type Culture Collection (ATCC, Manassas, VA, USA) and were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco; Thermo Fisher Scientific, Inc., Grand Island, NY, USA) containing 10% fetal bovine serum and penicillin-streptomycin at 37°C under a humidified atmosphere of 5% CO2. Each of the in vitro experiments was performed 3 times. Before transfection, LUAD cells were plated in 96-well plates at 2.5×103 cells/well and maintained at 37°C for 24 h. Blank control, negative mimic control, miR-183-5p mimic, negative inhibitor control and miR-183-5p inhibitor (Ambion; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) were transfected in LUAD cell lines at a final concentration of 60 nmol/l with Lipofectamine 2000 following the manufacturer's instructions. The concentration for transfections was determined based on previous studies (21 (link),22 (link)). miR-183-5p expression was detected with qPCR in Applied Biosystems PCR 7900 system as stated previously (23 (link)–26 (link)).
3
FFPE RNA Extraction and miR-542-5p Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For FFPE tissues, five sections were acquired from each tissue sample, at a thickness of 10 μm per section. Total RNA was extracted by the RNeasy FFPE Kit (NO. 73504) as stated by the manufacturer’s instructions. The concentration and purity of total RNA were confirmed with a NanoDrop 2000 spectrophotometer (Wilmington, DE, USA). Complimentary DNA was synthesized by total RNA and the TaqMan MicroRNA Reverse Transcription Kit (NO. 4366596) as described previously [13 (link)]. Subsequently, an Applied Biosystems PCR7900 system was used to carry out real-time quantitative reverse transcriptase-polymerase chain reactions (qRT-PCR) to detect and analyze the expression of miR-542-5p. The relative expression of miR-542-5p was calculated by 2-△Cq. RNA extraction and qRT-PCR were performed in June of 2014.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!