Gold chloride (HAuCl4, 99%), sodium borohydride (NaBH4, 99%), cetyltrimethylammonium bromide (CTAB), sodium oleate (NaOL, > 97%), l -ascorbic acid (AA), silver nitrate (AgNO3, 99%), hydrochloric acid (HCl, 95−98%), (3-mercaptopropyl)trimethoxysilane (MPTMS), and sodium chloride (NaCl) were purchased from Sigma-Aldrich (St. Louis, MO). Tris(2-carboxyethyl)phosphine (TCEP) was from Thermo Scientific (Rochester, NY). All the following DNA oligonucleotides were synthesized and HPLC-purified by Biosearch Technologies (Petaluma, CA). Single-strand DNA (ssDNA) sequences include thiolated 5′-SS-C6- TTTTAGAGATATGAGCAG-3′; 5′-SS-C6- TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCT-3′; and 5′-SS-C6- TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCTCGAGTACTACCAGGCTGCGACTCGTCAGACGTATAGTGA-3′. Fluorescence-labeled complementary ssDNA sequences: 5′-Quasar 670-CTGCTCATATCTCTAAAA-3′; 5′-Quasar 670- AGCCATCTCTCAGCCTCCTTTCCAGTTCTGCTCATATCTCTAAAA-3′; and 5′-Quasar 670- TCACTATACGTCTGACGAGTCGCAGCCTGGTAGTACTCGAGCCATCTC-TCAGCCTCCTTTCCAGTTCTGCTCATATCTCTAAAA-3′; Hairpin probe ssDNA is 5′-SS-C6-TTTTTTTTTCGACGAGAGATATGAGCAGAACTGGAAAGGAGGC-TGACGTCG-Quasar 670−3′, whereas the detection ssDNA is 5′-TCAGCCTCCTTTCCAGTTCTGCTCATATCTCT-3′.
Gold chloride
Manufactured by Merck Group
Sourced in United States
Gold chloride is a chemical compound with the formula AuCl3. It is a yellow, crystalline solid that is soluble in water and various organic solvents. Gold chloride is commonly used as a precursor in the synthesis of other gold compounds and as a reagent in various chemical processes.
Automatically generated - may contain errors
Lab products found in correlation
Trisodium citrate, by Merck Group (4 mentions)
Silver nitrate, by Merck Group (3 mentions)
L ascorbic acid, by Merck Group (3 mentions)
Cetyltrimethylammonium bromide, by Merck Group (2 mentions)
Sodium oleate, by Merck Group (2 mentions)
Hydrochloric acid (hcl), by Merck Group (2 mentions)
Sodium borohydride, by Merck Group (2 mentions)
3 mercaptopropyl trimethoxysilane, by Merck Group (2 mentions)
Chloroform, by Merck Group (2 mentions)
Dulbecco s modified eagle medium dmem, by Merck Group (2 mentions)
Tris 2 carboxyethyl phosphine tcep, by Thermo Fisher Scientific (1 mentions)
Sodium chloride (nacl), by Merck Group (1 mentions)
1 ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride edc, by Thermo Fisher Scientific (1 mentions)
N hydroxysulfosuccinimide sulfo nhs, by Thermo Fisher Scientific (1 mentions)
Hexane, by Merck Group (1 mentions)
Oleic acid, by Merck Group (1 mentions)
1 octadecene, by Merck Group (1 mentions)
Iron 3 oxide, by Merck Group (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
N hydroxysuccinimide, by Merck Group (1 mentions)
14 protocols using gold chloride
1
Synthesis and Characterization of Gold Nanoparticles
2
Synthesis of Citrate-Stabilized Nano Gold
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nano gold was synthesized via the tetrachloroauric(III) acid (HAuCl4.3H2O, Honeywell Fluka) reduction as per Frens 39 (link) procedures. Gold chloride (200 mL, 0.01% w/v, Sigma-Aldrich) solution was boiled (2 min), 4 mL of 1% (w/v) of tri-sodium citrate (Sigma-Aldrich) solution was then added rapidly and continued by heating until a wine-red color developed. The mixture was left to cool down to reach ambient temperature before storing at 4 °C.
3
Fabrication of Cardiac Troponin I Biosensor
4
Biotin-Conjugated Antibody-Magnetic Nanoparticle Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The biotin-conjugated rabbit antibody to E. coli O157:H7, O and K antigenic serotypes, was purchased from Meridian Life Science, Inc. (Memphis, USA). The carboxyl conjugated magnetic nanoparticles (MNPs) were purchased from Allrun Nano (PM3-020, Shanghai, China). Gold chloride (HAuCl4 · 3H2O), streptavidin, 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC·HCl), N-Hydroxysuccinimide (NHS), phosphate buffered saline (PBS, pH 7.4, diluted to 10 mM before use), Con A from Canavalia ensiformis (Jack bean, Type IV, lyophilized powder) were purchased from Sigma-Aldrich (St. Louis, MO, US). Bovine serum albumin (BSA) from EM Science (Gibbstown, NJ, US) was prepared in PBS for blocking. Dextran (40,000) was purchased from BBI (Sangon Biotech., Shanghai, China). Tween-20 was purchased from Amersco (Solon, OH, US) for washing. Other reagents were of analytical grade. Ultra-purified water produced by Advantage A10 from Millipore (Billerica, MA, USA) was used throughout.
5
Synthesis of Imidazole-based Polymers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1-Methylimidazole,
acetonitrile, diethylether, bromooctane, allylchloride, trisodium
citrate, and bis-acrylamide (Wako Co. Ltd.); acrylic acid, NIPAM,
1-allylimidazole, lithium bis(trifluoromethanesulfonyl)imide, and N,N,N′,N′-tetramethylenethylenediamine (TEMED) (Tokyo Chemical
Industry Co. Ltd.); bromohexane, ammonium persulphate,l (+)-ascorbic
acid, and gold chloride (Sigma-Aldrich); all were used as received.
acetonitrile, diethylether, bromooctane, allylchloride, trisodium
citrate, and bis-acrylamide (Wako Co. Ltd.); acrylic acid, NIPAM,
1-allylimidazole, lithium bis(trifluoromethanesulfonyl)imide, and N,N,N′,N′-tetramethylenethylenediamine (TEMED) (Tokyo Chemical
Industry Co. Ltd.); bromohexane, ammonium persulphate,
acid, and gold chloride (Sigma-Aldrich); all were used as received.
6
Chitosan-Based Antimicrobial Hydrogel Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Capsaicin was obtained from Sigma-Aldrich (St. Louis, MO, USA). Honey was obtained directly from beekeepers (Al-Maimouna, Maysan, Iraq). Dimethyl sulfoxide (DMSO) (≥99.8%), ketamine hydrochloride (≥99%), xylene hydrochloride (≥99%), tri-sodium citrate (≥99%), and gold chloride (≥99.9%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Chitosan (CS) (≥99%) with a molecular weight of 161 kDa was supplied by HiMedia Company (Mumbai, India). Tripolyphosphate (TPP) (105 kDa) was purchased from Sigma-Aldrich. Glacial acetic acid (99–100% purity) was purchased from Sisco Research Laboratories Pvt. Ltd. (Mumbai, India), and Muller–Hinton agar was prepared by Oxoid Company (London, UK). Aquacel® silver (Ag) was purchased from ConvaTec, Inc. (Deeside, UK). All cell culture materials, such as Dulbecco’s Modified Eagle Medium (DMEM) and fetal bovine serum (FBS) were purchased from Sigma-Aldrich, USA.
7
Synthesis and Characterization of Gold Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Folic acid, gold chloride,
dialysis sacks, Dulbecco’s modified Eagle medium (DMEM), and
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT)
were purchased from Sigma-Aldrich, USA. Sodium citrate, potassium
bromide (KBr), chloroform, hematoxylin, eosin, and paraffin wax were
purchased from Merck, Germany. Glucometer (AccuCheck), cholesterol,
and triglyceride kits were obtained from Span Diagnostics, Mumbai,
India. Alkaline phosphatase (ALP), serum glutamic oxaloacetic transaminase
(SGOT), and serum glutamic pyruvic transaminase (SGPT) kits were obtained
from Robonik-prietest-Clinical Chemistry Reagents, Mumbai. All other
reagents were of high analytical grade.
dialysis sacks, Dulbecco’s modified Eagle medium (DMEM), and
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT)
were purchased from Sigma-Aldrich, USA. Sodium citrate, potassium
bromide (KBr), chloroform, hematoxylin, eosin, and paraffin wax were
purchased from Merck, Germany. Glucometer (AccuCheck), cholesterol,
and triglyceride kits were obtained from Span Diagnostics, Mumbai,
India. Alkaline phosphatase (ALP), serum glutamic oxaloacetic transaminase
(SGOT), and serum glutamic pyruvic transaminase (SGPT) kits were obtained
from Robonik-prietest-Clinical Chemistry Reagents, Mumbai. All other
reagents were of high analytical grade.
8
Synthesis of Metal Nanomaterials
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Germanium (Ge, 99.999%), calcium (Ca, 99.0%), gold chloride (AuCl3, 99.99%), silver nitrate (AgNO3, 99.9999%), copper chloride (CuCl2, 99.999%), palladium chloride (PdCl2, 99.9%) and platinum chloride (PtCl4, 99.999%) were purchased from Sigma-Aldrich and hydrochloric acid (HCl, 37% w/w), ethanol (anhydrous) dichloromethane (HPLC grade) and toluene (HPLC grade) were purchased from Fisher Scientific. Milli-Q (18.2 MΩ cm at 25 °C) water was used for all experiments. All organic solvents were dried using an Innovative Technology, Inc. Grubbs-type solvent purification system.
9
Protocols for Neuronal Cell Culture and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Materials were acquired from the following sources: Gold chloride, poly (ethylene glycol) (PEG), poly-D-lysine (PDL), bovine serum albumin (BSA), colchicine and paraformaldehyde (PFA): Sigma-Aldrich, USA; Trisodium citrate dihydrate, papain, nitric acid, hydrogen peroxide, hydrochloric acid, TRIS-buffer, triton X-100, di-sodium hydrogen phosphate and potassium dihydrogen phosphate: Merck Chemicals, USA; Collagenase-II, dispase-II, fetal bovine serum (FBS), penicillin–streptomycin mix and trypsin–EDTA: Gibco, USA; Hank's buffered saline solution (HBSS), Ham’s F-12 medium and Dulbecco’s modified Eagle’s medium (DMEM): Lonza Chemicals, USA; Isolectin B4, DyLight 594-IB4, FITC-IB4, DyLight 488 horse anti-mouse IgG antibody and Vectashield hardset mounting medium: Vector Laboratories, USA; Glutaraldehyde (EM grade), osmium tetroxide (OsO4), sodium cacodylate trihydrate and EMBed-812 embedding kit: Electron Microscopy Sciences, USA; Hoechst 33342: Santa Cruz Biotechnology, Inc. USA; Anti β-III tubulin monoclonal antibody: Cell Signaling Technology, Inc USA; Anti PGP9.5 antibody: Abcam Plc UK; Microfluidic devices (SND 150): Xona Microfluidics, LLC, USA.
10
Electrochemical Biosensor for Serum RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase/RNase-free distilled water (Dalian Meilun Biotechnology Co., Ltd, China) was used throughout the experiments. Methylene blue and gold chloride (HAuCl4·4H2O) were supplied by Sigma (St. Louis, MO, USA). Screen printing inks were purchased from Jujo Chemical Co., Ltd (Tokyo, Japan) and a 0.3 mm rubber magnet sheet were purchased from Guangzhou Magnetic Material Co., Ltd (Guangzhou, China). Capture probes, RNA sequences and 20× SSC buffers were purchased from Sangon Biotechnology Inc. (Shanghai, China). The base sequences are in Table S1.† The normal human serum was obtained from Sir Run Run Shaw Hospital. Streptavidin-labeled magnetic beads (XFNANO, Materials Tech Co. Ltd. China) were 1 μm in diameter. All other chemicals not mentioned here were of analytical reagent grade. AuNPs modification and electrochemical measurements were performed using an electrochemical workstation (IVIUM, CompactStat.h). For evaluation of the morphology and structures of MBs, a field emission scanning electron microscope (Gemini 300, Zeiss) was used which was equipped with X-ray energy-dispersive spectrometry (EDS) for elemental composition analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!