L9655

Cytotoxicity was assessed in HepG2 and adipocyte cells (1.0 × 10⁵ cells/well in a standard 24-well culture plate) using Presto Blue^® from Thermo Fischer Scientific. The PB assay is a commercially available, ready-to-use, water-soluble preparation. Cells were incubated for 24 h with a 6 mM mixture of fatty acids (FAs) ratio 1:1 v/v (L9655-Sigma Aldrich) and then treated with the açai extract (0.25 mg/mL) at: 0.25, 0.625, 1.25, 2.5 µg/mL final concentration. After 24 h, the cells were incubated with Presto Blue reagent. Cell viability was measured spectroscopically (absorbance at 570 nm with a reference wavelength set at 600 nm) using a Bio-Rad multiwell plate reader (Bio-Rad Laboratories, Milan, Italy) and expressed as the percentage relative to the viability of cells untreated with the compound.

HepG2 cells (1 ×  10⁵ cells/cm²) were prepared with 6 mM of a mixture of fatty acids (FAs) based on linoleic acid (18:2, ω-6 fatty acid) and oleic (18:1, ω-9 fatty acid) in ratio 1:1 v/v (L9655-Sigma Aldrich) for 24 h and thus pre-treated for 30 min with 50 µM H₂O₂ and then incubated with the açai extract at different concentrations (0.25, 0.625, 1.25, 2.5 µg/mL) for 24 h. HepG2 not exposed to FA were treated for a control with 50 µM H₂O₂ for 30 min, the protein concentration of cell lysates was determined using the Bio-Rad protein assay reagent (Bio-Rad Laboratories, Milan, Italy). Lipid peroxidation was evaluated by quantifying thiobarbituric acid reactive substances (TBARS) as reported by Stellavato et al. (2018). The data represent the reduction percentage with respect to cells treated with H₂O₂. The mean ± standard deviation (SD) was calculated from 3 experiments, each with triplicate measurements.

Postnatal day 1 (P1) C57BL/6J mice were obtained from Tokyo Laboratory Animals Science. SOD1-G93A transgenic mice, that is express a G93A mutant form of human SOD1 were obtained from Jackson Laboratory (#002726) and heterozygous (SOD1^G93A) males were bred with wild-type (WT) female C57BL/6J mice (Japan SLC). Offspring were ear punched and genotyped using PCR with following primers: Human/Mouse Sod1 forward, CAGCAGTCACATTGCCCARGTCTCCAACATG; Human Sod1 reverse, CCAAGATGCTTAACTCTTGTAATCAATGGC; Mouse Sod1 reverse, GTTACATATAGGGGTTTACTTCATAATCTG. Mice not expressing the transgene were used as WT littermate controls. Mice were housed in an air-conditioned room at 22°C with a 12-h light–dark cycle, had free access to water and food, and were maintained in sterile, pathogen-free conditions. The mice were fed standard chow diets (CE-2, CLEA Japan) and water under ad libitum conditions.
Female SOD1^G93A mice were intraperitoneally administered with linoleic acid-oleic acid-albumin (10.6 mg/kg, L9655, Sigma-Aldrich) or bovine serum albumin (BSA; 1.25 g/kg, 810017, Sigma-Aldrich) twice a week between P60 and P100.