Fosmid (or plasmid) DNA was recovered from 5 mL cultures of each clone using the QIAprep Spin Miniprep kit (Qiagen) and used as templates for PCR. Primers were designed for the amplification of the selected genes (without signal sequences) and incorporation of the genes into the pASK-IBA16 expression vector (IBA GmbH). PCR-amplification of the xylanase genes was done using the iProof high-fidelity DNA polymerase (Bio-Rad). Cloning was performed using the recombination-based In-Fusion Advantage PCR cloning system (Clontech) and the completed reactions were used to transform Stellar competent E. coli cells (Clontech) according to manufacturer’s instructions. The constructed expression vectors were recovered using the QIAprep kit and correct sequences verified by Sanger sequencing.
Stellar competent e coli cells
Manufactured by Takara Bio
Stellar competent E. coli cells are high-efficiency bacterial cells designed for transformation and protein expression. They are engineered to efficiently take up and maintain foreign DNA, making them a useful tool for molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
In fusion cloning kit, by Takara Bio (3 mentions)
In fusion kit, by Takara Bio (2 mentions)
Complementary oligos, by Integrated DNA Technologies (2 mentions)
Zymopure maxiprep kit, by Zymo Research (2 mentions)
Iproof high fidelity dna polymerase, by Bio-Rad (1 mentions)
In fusion advantage pcr cloning system, by Takara Bio (1 mentions)
In fusion, by Takara Bio (1 mentions)
Cas9 mrna, by Thermo Fisher Scientific (1 mentions)
Pcr4blunt topo vector, by Thermo Fisher Scientific (1 mentions)
Opti mem 1, by Thermo Fisher Scientific (1 mentions)
M9 minimal medium, by Merck Group (1 mentions)
E coli bl21 de3, by New England Biolabs (1 mentions)
In fusion hd enzyme, by Takara Bio (1 mentions)
In fusion technology, by Takara Bio (1 mentions)
12 protocols using stellar competent e coli cells
1
Xylanase Gene Cloning and Expression
2
Optogenetic Nanobody Engineering
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA containing LaM8, LaM4, and LaG9 was kindly gifted by Professor Kole Roybal (UCSF), and a plasmid encoding the anti-actin nanobody was purchased from Chromotek. All DNA was cloned using backbone PCR and inFusion (Clontech). pHR vectors were used for mammalian cell experiments and pBAD vectors were used for bacterial protein overexpression. AsLOV2 404–546 and AsLOV2 408–543 were ordered as gene blocks from IDT and used to insert into the nanobodies using inFusion (Clontech). The BFP-SSPB-SOScat-2A-PuroR-2A-iLID-CAAX plasmid was used to express the iLID/SSPB dimerization system as a single transgene52 (link). All plasmids were cloned by amplifying appropriate sequences by PCR and performing assembly reactions using the inFusion kit (Clontech). All final plasmids were validated by sequencing (Genewiz). Stellar competent E. coli cells (Clontech) were transformed according to manufacturer’s instructions for all plasmid transformations. All OptoNB plasmids are available upon request from the authors or from the Addgene repository (accession number forthcoming).
3
Plasmid Construction and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid encoding human EPOR was a gift from J. Tavernier (Ghent University) and was subcloned into a pHR backbone before site-directed mutagenesis was conducted to introduce the mutations described in the study. The plasmid encoding human STAT1 was a gift from A. Perantoni (NCI, Addgene #12301) and was subcloned into a pHR backbone encoding mCherry. H2B was ordered as a gblock gene fragment from Integrated DNA Technologies (IDT) and inserted into a pHR backbone encoding mIRFP. All plasmid backbones were either digested with the appropriate restriction enzymes or linearized by PCR amplification. Inserts were cloned by PCR amplification or synthesized (IDT). Assembly reactions were performed with the inFusion kit (Clontech), and stellar competent E. coli cells (Clontech) were transformed according to manufacturer's instructions. All final plasmids were validated by sequencing (Eton Bioscience or Genewiz).
4
Vps51 Point Mutations Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Glu127 residue of Vps51 was replaced with Lysine (GAA to AAA) using the PhusionTM site-directed mutagenesis kit (Thermo Fisher-Scientific). In summary, purified pGADT7-Vps51 (KKD 0156) or purified pRS426-Vps51-mRFP (KKD 0298) was used a template and amplified with primers carrying the point mutation. Then, the linear DNA product was ligated and introduced into 'Stellar' competent E.coli cells (Clontech). The mutated plasmid DNA was extracted from three colonies using QIAprep® Spin Miniprep Kit (Qiagen), and the presence of the mutation was confirmed by sequencing (Eurofins Genomics). A similar approach was used to create another point mutant Y129F (TAT to TTT) and a double mutant (EY127, 129KF). The mutated copies of Vps51 were introduced into appropriate yeast strains by the transformation protocol mentioned in the previous section.
5
Knockout of Gene in RPE-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPE-1 cells were cultured overnight at a density of 0.1 × 106. For transfection, 375 ng of synthetic sgRNA (TrueGuide™, CRISPR932782_SGM; sgRNA sequence: GGTCTTCAAGTAGCTCTACA) along with 6 µL Cas9 mRNA (Invitrogen), and 18 µL of the MessengerMAX™ reagent (Invitrogen) were separately diluted in 300 µL Opti-MEM™ I (Gibco) each. After 10 min of incubation at room temperature, both mixtures were combined and added to the plate at 100 µL per well. The cells were kept in culture for another 48 h, trypsinized and transferred to a 96-well plate in serial two-fold dilution, starting with 4,000 cells. Wells containing single colonies were identified under a transluminescence microscope and progressively expanded to larger culture volumes. One successful knock-out clone could be identified by means of immunofluorescence as well as western blotting of total cell extracts. A bi-allelic single dA insertion at position 5110 of the gene was confirmed by subcloning the targeted area into a pCR™4Blunt-TOPO® vector (Invitrogen) and subsequent colony sequencing of transformed Stellar™ Competent E. coli cells (Takara).
6
Cultivation of Pseudomonas protegens and E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
Pseudomonas protegens Pf-5 was routinely grown in Luria–Bertani (LB) medium supplemented with kanamycin (20 μg/ml), gentamicin (5 μg/ml) or tetracycline (25 μg/ml) when appropriate. Stellar Competent E. coli cells (Takara Bio) were routinely grown in LB medium supplemented with kanamycin (50 μg/ml), gentamicin (15 μg/ml) and carbenicillin (100 μg/ml) when appropriate. All strains were grown overnight either with shaking at ∼220 rpm or statically at either 30°C (for P. protegens) or 37°C (for E. coli), unless otherwise noted. M9 minimal medium (Sigma) was supplemented with 1 mM MgSO4, 100 mM CaCl2 and 20 mM glucose.
+ Expand
Pseudomonas protegens Pf-5 was routinely grown in Luria–Bertani (LB) medium supplemented with kanamycin (20 μg/ml), gentamicin (5 μg/ml) or tetracycline (25 μg/ml) when appropriate. Stellar Competent E. coli cells (Takara Bio) were routinely grown in LB medium supplemented with kanamycin (50 μg/ml), gentamicin (15 μg/ml) and carbenicillin (100 μg/ml) when appropriate. All strains were grown overnight either with shaking at ∼220 rpm or statically at either 30°C (for P. protegens) or 37°C (for E. coli), unless otherwise noted. M9 minimal medium (Sigma) was supplemented with 1 mM MgSO4, 100 mM CaCl2 and 20 mM glucose.
7
Cloning and Mutant Generation of Plant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning of CrPAS (MH213134), CrDPAS (KU865331), CS (MF770512) and TS (MF770513) was reported in Caputi et al.2 . Cloning of DPAS and CorS from Tabernanthe iboga was reported in Farrow et al.6 . CS, TS and CorS mutants were generated by overlap extension PCR. The codon(s) to be mutated was selected and two primers, one reverse and one forward (Supplementary Table 3 ), were designed to overlap and introduce the mutation. PCR products were gel purified, ligated into pOPINF expression vector19 (link) using the In-Fusion cloning kit (Clontech Takara) and transformed into competent E. coli Stellar cells (Clontech Takara) according to the manufacturer’s instructions. Mutant constructs were sequenced to verify the mutant gene sequence and correct insertion.
8
Cloning and Mutant Generation of Plant Genes
9
Cloning Cas9/gRNA Constructs for CRISPR Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All CRISPR gRNAs used in SGE and essentiality experiments were cloned into pX45924 (link). This plasmid expresses the gRNA from a U6 promoter, as well as a Cas9–2A-puromycin resistance (-puroR) cassette. S. pyogenes Cas9 target sites were chosen for SGE experiments on multiple criteria, assessed in the following order: 1.) To induce cleavage within BRCA1 coding sequence, 2.) To target a genomic site permissive to synonymous substitution within the guanine dinucleotide of the PAM or the protospacer, 3.) To have minimal predicted off-target activity47 (link), 4.) To have maximal predicted on-target activity48 (link).
Complementary oligos ordered from Integrated DNA Technologies (IDT) were annealed, phosphorylated, diluted and ligated into BbsI-digested and gel-purified pX459, as described24 (link). Ligation reactions were transformed into E. coli (Stellar competent cells, Takara), which were plated on ampicillin. Colonies were cultured and Sanger sequenced to confirm correct gRNA sequences. Purification of sequence-verified plasmids for transfection was performed with the ZymoPure Maxiprep kit (ZymoResearch). For targeting LIG4 in HAP1 cells, pX45824 (link) was used instead of pX459, which expresses EGFP in lieu of puroR.
Complementary oligos ordered from Integrated DNA Technologies (IDT) were annealed, phosphorylated, diluted and ligated into BbsI-digested and gel-purified pX459, as described24 (link). Ligation reactions were transformed into E. coli (Stellar competent cells, Takara), which were plated on ampicillin. Colonies were cultured and Sanger sequenced to confirm correct gRNA sequences. Purification of sequence-verified plasmids for transfection was performed with the ZymoPure Maxiprep kit (ZymoResearch). For targeting LIG4 in HAP1 cells, pX45824 (link) was used instead of pX459, which expresses EGFP in lieu of puroR.
10
Expression and Purification of KAT8 Catalytic Domain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KAT8
plasmid was obtained by inserting the gene fragment encoding the catalytic
domain of KAT8 (amino acids 173–458) plus an N-terminal 6×His tag and the TEV protease cleavage site into
a pET28b expression vector (Novagen) between NcoI and XhoI cloning
sites, using an In-Fusion cloning kit (Clonetech). The plasmid was
amplified by transforming it into E. coli Stellar Competent Cells (Takara), and the DNA sequence was verified
by Sanger sequencing. The plasmid was transformed in E. coli BL21(DE3) (New England Biolabs). Cells were
grown in LB media supplemented with 50 μg/mL kanamycin at 37
°C. When cultures reached optical density at 600 nm (OD600) of
∼0.6, isopropyl-β-d -1-thiogalactopyranoside
(IPTG) was added at a final concentration of 0.5 mM and cultures were
further grown for 18 h at 16 °C. Cells were collected by centrifugation
at 5000×g for 10 min at 4 °C.
plasmid was obtained by inserting the gene fragment encoding the catalytic
domain of KAT8 (amino acids 173–458) plus an N-terminal 6×His tag and the TEV protease cleavage site into
a pET28b expression vector (Novagen) between NcoI and XhoI cloning
sites, using an In-Fusion cloning kit (Clonetech). The plasmid was
amplified by transforming it into E. coli Stellar Competent Cells (Takara), and the DNA sequence was verified
by Sanger sequencing. The plasmid was transformed in E. coli BL21(DE3) (New England Biolabs). Cells were
grown in LB media supplemented with 50 μg/mL kanamycin at 37
°C. When cultures reached optical density at 600 nm (OD600) of
∼0.6, isopropyl-β-
(IPTG) was added at a final concentration of 0.5 mM and cultures were
further grown for 18 h at 16 °C. Cells were collected by centrifugation
at 5000×g for 10 min at 4 °C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!