Log In Sign up
The largest database of trusted experimental protocols

Rpmi 1640 medium

Manufactured by Cytiva
Visit Supplier
Sourced in United States, China

RPMI-1640 medium is a cell culture medium commonly used for the in vitro cultivation of various cell types, including lymphocytes, hybridomas, and other mammalian cells. It provides a balanced set of essential nutrients and a buffering system to support cell growth and maintenance.

Automatically generated - may contain errors

Lab products found in correlation

Fetal bovine serum (fbs), by Thermo Fisher Scientific (55 mentions) Fetal bovine serum (fbs), by Cytiva (51 mentions) Penicillin, by Thermo Fisher Scientific (18 mentions) Dulbecco modified eagle medium (dmem), by Cytiva (17 mentions) Streptomycin, by Thermo Fisher Scientific (16 mentions) Penicillin streptomycin, by Cytiva (14 mentions) Penicillin, by Cytiva (12 mentions) Streptomycin, by Cytiva (12 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (11 mentions) Dimethyl sulfoxide (dmso), by Merck Group (11 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (11 mentions) L glutamine, by Cytiva (9 mentions) Streptomycin, by Merck Group (6 mentions) Fetal bovine serum (fbs), by Merck Group (6 mentions) Hyclone, by Cytiva (6 mentions) Dulbecco s modified eagle s medium, by Cytiva (5 mentions) Fetal calf serum (fcs), by American Type Culture Collection (5 mentions) Fluo 4 am, by Thermo Fisher Scientific (5 mentions) Penicillin streptomycin, by Beyotime (5 mentions) Fetal calf serum (fcs), by Thermo Fisher Scientific (5 mentions)

Close spelling variants of this product

RPMI 1640 (169 citations) RPMI medium (10 citations) 1640 medium (9 citations) Complete RPMI 1640 medium (3 citations) RPMI-1640) culture medium (3 citations) 1640 medium (RPMI-1640), (2 citations) HyClone RPMI-1640 Medium (2 citations)

212 protocols using rpmi 1640 medium

1

Lentiviral Knockdown of PNO1 in Human Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture.
The human PCa cell lines, DU145 and PC-3, were purchased from the American Type Culture Collection (Manassas, VA, USA). All cells were cultured in RPMI-1640 medium (HyClone Laboratories; USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scienti c, Inc. USA) at 37°C in a humidi ed atmosphere with 5% CO 2 .
Lentiviral constructs and transfections.
The PNO1 shRNA sequences were got from GeneChem Co., Ltd. (Shanghai, China). Recombinant lentiviral vectors carrying PNO1 shRNA were constructed in accordance to manufacturer's instruction [17] .
PNO1 shRNA-1 was CCGGCCCATGATTGACCAGTCAAATTTCAAGAGAATTTGACTGGTCAATCATGGGTTTTTG.
Hu J., Cui F., Xv Z., Tan J., & Wang Z. (2020). PNO1 promotes cell proliferation in prostate cancer.
+ Open protocol
+ Expand
2

Cell Culture Conditions and Enumeration

Check if the same lab product or an alternative is used in the 5 most similar protocols
THP-1 (TIB-202), JEG-3 (HTB-36), BeWo (CCL-98), and Caco-2 (HTB-37) cells were purchased from the American Type Culture Collection. ASC-GFP–expressing THP-1 cells (thp-ascgfp) and reporter HEK-Blue cells for IL-1R (hkb-il1r) and IFNLR (hkb-ifnl) were purchased from InvivoGen. THP-1 cells were cultured in RPMI-1640 medium (SH30027.01; HyClone Laboratories) supplemented with 10% Gibco FBS (26140079; Life Technologies) with Gibco L-glutamine (25030; Life Technologies) and 1% penicillin/streptomycin (17-602E; Lonza) and were maintained at 37°C in an incubator at densities of 1 × 104 to 106 cells/ml. BeWo cells were cultured in Gibco Ham’s F-12K media with Kaighn’s modification (21127-022; Life Technologies) and containing 10% FBS with 1% penicillin/streptomycin. JEG-3 cells were cultured in Gibco Eagle's MEM (12492-013; Life Technologies) supplemented with 10% FBS and 1% penicillin/streptomycin. Caco-2 cells were cultured in Gibco DMEM (10-017-CV; Life Technologies) supplemented with 10% FBS and 1% penicillin/streptomycin. Cells were enumerated using a TC20 cell counter (catalog no. 1450102; Bio-Rad Laboratories).
Megli C., Morosky S., Rajasundaram D, & Coyne C.B. (2020). Inflammasome signaling in human placental trophoblasts regulates immune defense against Listeria monocytogenes infection. The Journal of Experimental Medicine, 218(1), e20200649.
+ Open protocol
+ Expand
3

Knockdown of PNO1 in Human Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture.
The human PCa cell lines, DU145 and PC-3, were purchased from the American Type Culture Collection (Manassas, VA, USA). All cells were cultured in RPMI-1640 medium (HyClone Laboratories; USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scienti c, Inc. USA) at 37°C in a humidi ed atmosphere with 5% CO 2 .
Lentiviral constructs and infections.
The PNO1 shRNA sequences were got from GeneChem Co., Ltd. (Shanghai, China). Recombinant lentiviral vectors carrying PNO1 shRNA were constructed in accordance to manufacturer's instruction [17] .
PNO1 shRNA-1 was CCGGCCCATGATTGACCAGTCAAATTTCAAGAGAATTTGACTGGTCAATCATGGGTTTTTG.
Hu J., Cui F., Xv Z., Tan J., & Wang Z. (2020). PNO1 promotes cell proliferation in prostate cancer.
+ Open protocol
+ Expand
4

Culturing Normal and Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal lung fibroblast cells (MRC-5) and non-small lung cancer cells (A549 and NCI-H1299) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and Korea Cell Line Bank (KCLB) (Seoul, Korea). Cells were cultured on minimum essential media (MEM, Hyclone Laboratories, Logan, Utah, USA) for MRC-5, Dulbecco’s Modified Eagle Medium (DMEM, Hyclone Laboratories) for A549 and RPMI 1640 medium for NCI-H1299 (Hyclone Laboratories) supplemented with 10% fetal bovine serum (FBS, Hyclone Laboratories) and 1% penicillin/streptomycin (Hyclone Laboratories). The cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2.
Yu S.L., Koo H., Lee S.I., Kang J., Han Y.H., Yeom Y.I, & Lee D.C. (2020). A Synthetic CPP33-Conjugated HOXA9 Active Domain Peptide Inhibits Invasion Ability of Non-Small Lung Cancer Cells. Biomolecules, 10(11), 1589.
+ Open protocol
+ Expand
5

Stable Luciferase-Expressing Lewis Lung Carcinoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lewis lung carcinoma cells (3LL) were kindly provided by Raphael Nemenoff (University of Colorado, Denver, CO, USA) and stably transfected with pCCL-MNDU3-LUC plasmid containing the firefly luciferase gene as previously described (Supplementary Fig. 1, see section on supplementary data given at the end of this article) (Christoph et al. 2013 ). The cell line was validated before start of the experiments by short tandem repeats (Microsynth Seqlab, Göttingen, Germany). Cells were cultured in RPMI 1640 medium (Hyclone Laboratories, Logan, UT, USA) supplemented with 10% fetal bovine serum in 5% CO 2 at 37°C to 65-70% confluence. For the proliferation assay, cells were grown in RPMI 1640 medium with 10% fetal bovine serum (FBS) depleted of TH by treatment of FCS with anion exchange resin (Aldrich Amberlite IRA-400 Cl, Sigma) and charcoal. Thyroid hormone concentration was below the limit of detection after treatment. T 4 , T 3 and Tetrac were dissolved in DMSO, which was also used as control.
Latteyer S., Christoph S., Theurer S., Hönes G.S., Schmid K.W., Führer D, & Moeller L.C. (2019). Thyroxine promotes lung cancer growth in an orthotopic mouse model. Endocrine-related cancer, 26(6).
+ Open protocol
+ Expand
6

Monocyte Transmigration Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Purified monocytes (5.3×10 6 /ml) were added to the (upper) top compartment of a chemotaxis chamber (MultiScreen 96-well filtration plate, 5.0 μm polycarbonate sterile, Millipore), and allowed to transmigrate at 37 • C for 3 h against RPMI 1640 medium (Hyclone Laboratories Inc.) or plasma from healthy or HUS children (diluted at 50 %) in the lower compartment.
Ramos M.V., Ruggieri M., Panek A.C., Mejias M.P., Fernandez-Brando R.J., Abrey-Recalde M.J., Exeni A., Barilari C., Exeni R, & Palermo M.S. (2015). Association of haemolytic uraemic syndrome with dysregulation of chemokine receptor expression in circulating monocytes. Clinical science (London, England : 1979), 129(3).
+ Open protocol
+ Expand
7

Cell Line Cultivation for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cell lines were obtained from the American Type Culture Collection (Rockville, MD, USA). The HL-60 and Kasumi-1 human acute myeloid leukemia cell lines were maintained in RPMI-1640 medium (Hyclone Laboratories, Logan, UT, USA) supplemented with 10% fetal bovine serum (Life Technologies, Inc., Grand Island, NY, USA) and 1% L-glutamine (Life Technologies, Inc.). The PLC, BEL-7404 and Huh7 human liver cancer cell lines and the H1299 human lung cancer cell line were maintained in Dulbecco’s modified Eagle’s medium (Hyclone Laboratories) supplemented with 10% fetal bovine serum and 1% L-glutamine.
LI N., DONG G., WANG S., ZHU S., SHEN Y, & LI G. (2014). Pinellia pedatisecta agglutinin-based lectin blot analysis distinguishes between glycosylation patterns in various cancer cell lines. Oncology Letters, 8(2), 837-840.
+ Open protocol
+ Expand
8

Cell Culture and Virus Propagation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK-293T cells were cultured in Dulbecco modified Eagle medium (DMEM, Hyclone Laboratories, USA) supplemented with 100 IU/mL of penicillin plus 100 μg/mL streptomycin and 10% fetal bovine serum (FBS). Porcine alveolar macrophages (PAMs, 3D4/21) were cultured in RPMI 1640 medium (Hyclone Laboratories) which contains 100 IU/mL of penicillin plus 100 μg/mL streptomycin and 10% FBS. Cells were grown at 37°C in a 5% CO2 humidified incubator. The Vesicular Stomatitis Virus (VSV-GFP) and Herpes Simplex Virus-1 (HSV-1-GFP) were both provided by Dr. Tony Wang in SRI International USA.
Luo J., Zhang J., Ni J., Jiang S., Xia N., Guo Y., Shao Q., Cao Q., Zheng W., Chen N., Zhang Q., Chen H., Chen Q., Zhu H., Meurens F, & Zhu J. (2022). The African swine fever virus protease pS273R inhibits DNA sensing cGAS-STING pathway by targeting IKKε. Virulence, 13(1), 740-756.
+ Open protocol
+ Expand
9

Culturing Diverse Pancreatic Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human pancreatic cancer cell lines BxPC3, SW1990, and PANC-1 were purchased from iCell Bioscience Inc (Shanghai, China). HS766T and colo357 cell lines were obtained from Shanghai Jining Shiye (Shanghai, China). PCI-35 cell was purchased from Hangzhou Young Eagle Biotechnology Co., Ltd (Hangzhou China). PANC-1, HS766T, and Colo357 cells were cultured in Dulbecco’s modified Eagle medium, while SW1990, BxPC3, and PCI-35 cells were grown in RPMI-1640 medium (HyClone Laboratories Inc., Waltham, Massachusetts, USA). All medium contained 10% fetal bovine serum (FBS, Zhejiang Tianhang Biotechnology Co., Ltd. Hangzhou, China), penicillin (100 U/ml), and streptomycin (100 µg/ml). Cells were maintained at 37°C in a humidified atmosphere of 5% CO2.
Liu X., Zhou Y., Peng J., Xie B., Shou Q, & Wang J. (2020). Silencing c-Myc Enhances the Antitumor Activity of Bufalin by Suppressing the HIF-1α/SDF-1/CXCR4 Pathway in Pancreatic Cancer Cells. Frontiers in Pharmacology, 11, 495.
+ Open protocol
+ Expand
10

Culturing K562 and HEL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Routine K562 cell culture was carried out in RPMI 1640 medium containing 10% FBS. HEL cells were cultured in RPMI 1640 medium with 4.5 g/l glucose, 10 mM HEPES, and 1 mM sodium pyruvate, supplemented with 10% FBS.
K562 and HEL cells were obtained from the American Type Culture Collection (Manassas, VA). RPMI 1640 medium and fetal bovine serum were purchased from Hyclone Laboratories Inc. (Logan, UT).
Han S.H., Kim J., Her Y., Seong I., Park S., Bhattarai D., Jin G., Lee K., Chung G., Hwang S., Bae Y.S, & Kim J. (2015). Phytosphingosine promotes megakaryocytic differentiation of myeloid leukemia cells. BMB Reports, 48(12), 691-695.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!

  Request a quote for « Rpmi 1640 medium »