Skov3

The human ovarian surface epithelial cell line OSE (#7310, ScienCell Research Laboratories) were grown in ovarian epithelial cell medium (ScienCell Research Laboratories). EOC cell lines are high grade serous ovarian cancer, including ES-2, OVCAR3, and CAOV-3. ES-2 (#CRL-1978, ATCC) were cultured in McCoys 5A Medium that was supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo). OVCAR3 (#HTB-161, ATCC) were maintained in 20% FBS-supplemented RPMI-1640 medium (Gibco, Thermo) and bovine insulin (0.01 mg/ml, Gibco, Thermo). CAOV-3 (#SCSP-570, National Collection of Authenticated Cell Cultures) were maintained in 10% FBS-supplemented DMEM (Gibco, Thermo). SK-OV-3 (#TCHu185, National Collection of Authenticated Cell Cultures) were cultured in McCoys 5A Medium that was supplemented with 10% FBS (Gibco, Thermo). All cell lines aforementioned were cultured at 37°C an incubator containing a humidified atmosphere with 5% CO₂.

The epithelial ovarian cancer cells lines, including OVCAR3, A2780 and SKOV3 were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). OVCAR3 and A2780 cells were cultured in RPMI-1640 medium, whereas SKOV3 cells were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA, USA). They were supplemented with 10% fetal bovine serum (Sangon Biotech, Shanghai, China) and 1% penicillin-streptomycin (Solarbio, Beijing, China) at 37°C in 5% CO2. All OC cell lines were authenticated using short tandem repeat DNA testing at the Center for DNA Typing of the Fourth Military Medical University (FMMU, Xi’an, China).
OC tissue samples were collected from 100 patients who underwent surgery without neoadjuvant chemotherapy at the Department of Obstetrics and Gynecology of the First Hospital of Lanzhou University (Lanzhou, China) from 2011 to 2020. The clinical characteristics of OC patients are listed in Supplementary Table S1. All participants provided written informed consent. This study was approved by the Ethics Committee of the First Hospital of Lanzhou University.

The human ovarian cancer cell line SKOV3 and human embryonic kidney cell line HEK293T were obtained from the National Collection of Authenticated Cell Cultures (Beijing, China). SKOV3 cells were cultured in McCoy’s 5A medium modified (KeyGEN BioTECH, Jiangsu, China). HEK293T cells were maintained in DMEM medium (Gibco, Carlsbad, CA, USA). All the mediums were supplemented with 10% fetal bovine serum (FBS, Ausbian, Australia) and 100 U/mL penicillin–streptomycin mixture (Solarbio, Beijing, China). All cells were incubated at a temperature of 37 °C under 5% CO₂.

SKOV3 and HEY cells were obtained from National Collection of Authenticated Cell Cultures (Beijing, China). The cells were cultured with RPMI 1640 and McCoy's 5A media, respectively, supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin, and the cell culture was maintained at 37°C in a humidified chamber with 5% CO₂. After reaching 80% confluence, the cells were continuously exposed to different concentrations of CFG for 24 h.

The cell lines SKOV-3, A2780, HEY, and IOSE 80 were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). siRNA against human AC005562.1 were synthesized by GenePharma (Shanghai, China), and transfected into cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Total RNA has been extracted from cells using TRIzol Reagent(Invitrogen, Carlsbad, CA, USA). According to the manufacturer’s instructions for the Reverse Transcription Kit (EnzyArtisan, China), RNA was reversely transcribed into cDNA. Using cDNA as a template, 2 × S6 Universal SYBR qPCR Mix (EnzyArtisan, China) and quaint studio 7 flex real-time PCR system (ThermoFisher) were going to detect real-time Quantitative PCR(rt-qPCR).
The transfected OC cells were seeded in 96-well plates, and cell proliferation was measured using cell counting kit-8(CCK-8)(Dojindo, Tokyo, Japan). In addition, the AC005562.1 primers were the following: AC005562.1 -F, 5′- tggtcgtcatggaccggaag -3′; AC005562.1 -R: 5′- cttgcgagccaaaagtcctc -3′.