Cdna synthesis kit

RNA was extracted following the manufacturer’s instructions (BioRad, Hercules, CA, USA) and quantified using a NanoDrop DR 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA USA). cDNA was synthesized from 1 μg of RNA, using the NZYTech cDNA synthesis kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s recommendations, and employing the following thermocycling parameters: 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min. The qRT-PCR reaction was performed in a total volume of 10 μl employing an QuantStudio 5 equipment (Applied Biosystems, Foster City, CA, USA), using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and the following thermocycling parameters: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min; melting stage employed 95°C for 15 s, 60°C for 1 min, and 95°C for 30 s. Primer pairs used to detect target gene transcripts are listed in Table 1. Gene expression was analysed by the comparative CT (ΔΔCT) method and the expression level of all target genes was normalized to that of Hprt.

Total RNA was purified from the liver using the TripleXtractor direct RNA kit (Grisp), according to the manufacturer’s instructions. cDNA was synthesized from 1 µg of RNA using random primers and the NZYTech cDNA synthesis kit (NZYTech, Lisbon, Portugal). Quantification was performed with NZYSpeedy qPCR Green Master Mix (2x), ROX (NZY Tech, Lisbon, Portugal) using an Applied Biosystems ViiA7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Sterol regulatory element binding transcription factor 1 (srebf1) RNA was quantified using predesigned KiCqStart^® SYBR^® Green Primers (M_Srebf1_1; Sigma-Aldrich). For the other genes the following primers (forward/reverse) were used: fatty acid synthase (fas): GGAGGTGGTGATAGCCGGTAT/TGGGTAATCCATAGAGCCCAG; hypoxanthine-guanine phosphoribosyl transferase (Hprt;reference gene): TTTGCTGACCTGCTGGATTAC/CAAGACATTCTTTCCAGTTAAAGTTG; P. berghei 18S rRNA: AAGCATTAAATAAAGCGAATACATCCTTAC/GGAGATTGGTTTTGACGTTTATGTG.

RNA was extracted following the manufacturer’s instructions and quantified using a NanoDrop DR 1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA USA). cDNA was synthesized from 1 μg of RNA, using the NZYTech cDNA synthesis kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s recommendations, and employing the following thermocycling parameters: 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min. The qRT-PCR reaction was performed in a total volume of 10 μl reaction employing an Applied Biosystems StepOne Plus equipment (Applied Biosystems, Foster City, CA, USA), using the SYBR Green PCR Master Mix (Applied Biosystems) and the following thermocycling parameters: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min, melting stage was done at 95°C for 15 s, 60°C for 1 min, and 95°C for 30 s. Primer pairs used to detect target gene transcripts are listed in Table 1. Gene expression was analyzed by the comparative CT method (ΔΔCT) and the expression level of all target genes was normalized to that of Hprt.