The largest database of trusted experimental protocols

12 protocols using metafectene reagent

1

Mammalian Cell Culture Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T and mammary cells were cultured at 37°C in DMEM containing 1 µg/ml of streptomycin, 100 units/ml of penicillin, and 10% fetal bovine serum (FBS). For treatment with estradiol, cells were grown in the same medium containing phenol red-free DMEM supplemented with 5% charcoal-filtered FBS (i.e., estradiol-stripped medium). All media were obtained from Hyclone Laboratories (USA). Plasmids were transfected to cells by using Lipofectamine with PLUS reagent (Thermo Fisher Scientific), NeonTM Transfection System (Thermo Fisher Scientific), Metafectene reagent (Biontex Laboratories, Germany), or jetPEI™ DNA Transfection Reagent (Polyplus-transfection, France).
+ Open protocol
+ Expand
2

SLAMF1-GFP Transfection in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were grown in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific), containing 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 0.1 mM non-essential amino acids and supplemented with 5% FBS. SLAMF1-GFP vector transfection into HEK293T cells was performed using the Metafectene reagent (Biontex). Briefly, cells were seeded in 35mm / well of 6-well plates (2x105 cells / well) and maintained in 5% FBS RPMI 1640 medium (GIBCO) without antibiotics overnight. Subsequently, the SLAMF1-GFP vector and Metafectene were separately diluted in RPMI medium without serum or antibiotics for 5 minutes at room temperature. Then the dilutedSLAMF1-GFP vector DNA (8μg) and Metafectene (20μl) were mixed for 20 minutes. After this time, the mixture was added to the cell culture and incubated at 37° and 5% CO2 for 24 h. Finally, the medium was replaced by complete RPMI medium 5% FBS and incubated 24 h at 37ºC 5%CO2.
+ Open protocol
+ Expand
3

Silencing PGC-1α in Human Liver Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
In total, two siRNA sequences targeting different sites of human PGC-1α cDNA and another negative control sequence were designed and synthesized by Genesil (Wuhan, PR China). siRNA was transfected into L02 cells using the Metafectene reagent (Biontex, Munich, Germany) according to the manufacturer's instruc tions. At 48 h after medium replacement, cells were harvested for total RNA isolation, and PGC-1α expression levels were analyzed by semi RT-PCR. The siRNA sequences used in the experiments are as follows: S1: 5′-GACGGAUUGCCCUCAU UUG-3′, S2: 5′-GAGCCGUCUCUACUUAAGA-3′, and S3: 5′-GCUUCAUAAGGCGCAUAGC-3′ (a non-specific oligonucleotide used as a negative control).
+ Open protocol
+ Expand
4

Transient Transfection of HEK-293T and C/EBPα-/-MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK-293T and C/EBPα-/-MEFs were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) containing 10% FCS. Transient transfection with HEK-293T cells and C/EBPα-/-MEFs were performed by calcium phosphate method or with Metafectene reagent according to the manufacturer's protocol (Biontex). All experiments were repeated at least 3 times.
+ Open protocol
+ Expand
5

Transient HCV Polyprotein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The experimental setup to perform replication-independent, transient polyprotein expression has been described [43 (link)]. Viral polyproteins were expressed from pcite NS3-NS5B encoding HCV nonstructural proteins NS3-NS5B of genotype 1b (Con1) or genotype 2a (JFH1), respectively. Briefly, for SDS-PAGE and Western blot analysis of viral proteins 2 x 106 Huh-7/T7 cells were infected with MVA-T7pol vaccinia virus [110 (link)] and subsequently transfected with 8 μg of the respective plasmid DNA by using a PEI transfection protocol. Additional infection of Huh7-T7 cells with MVA-T7 was used to boost the expression of T7 RNA polymerase to allow efficient replication-independent expression of the HCV polyprotein. In the case of IF analysis for protein localization Huh7-Lunet/T7 cells were transfected with 8 μg of the indicated plasmid DNA by Metafectene reagent (Biontex Laboratories GmbH, Munich, Germany) without prior MVA-T7pol vaccinia virus infection.
+ Open protocol
+ Expand
6

RhoA/Cdc42 FRET Sensor Live Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols
NG108-15 neuroblastoma cells were purchased from Sigma Aldrich and grown in Dulbecco's modified Eagle's medium (DMEM) with 10% (v/v) fetal bovine serum (FBS) (Invitrogen), 100 μg/ml streptomycin and 100 units/ml in penicillin in a 5% CO2atmosphere at 37°C. For live cell imaging studies, cells were seeded on glass coverslips, coated for 3 h with laminin (50 μg/ml, L2020 Sigma) in 12-multiwell plates. Cells were transfected 24 h later with intermolecular RhoA/Cdc42 FRET sensors (Murakoshi et al., 2011 (link)) using Metafectene reagent (Biontex Laboratories) following the manufacturer's protocol and imaged 1 day after transfection. mEGFP-RhoA-C1 (Addgene plasmid #29674), mEGFP-Cdc42-C1 (Addgene plasmid #29673), mCherry-Rhotekin(8–89)-mCherry-C1 (Addgene plasmid #29675) and mCherry-Pak3(60–113)/S74A/F84A-mCherry-C1 (Addgene plasmid #29676) were a gift from Ryohei Yasuda (Murakoshi et al., 2011 (link)).
+ Open protocol
+ Expand
7

HCV Nonstructural Protein Expression in Huh7/T7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The applied procedures have been described [35 (link)]. HCV nonstructural proteins were expressed from pcite_ plasmids. Briefly, 2 x 106 Huh7/T7 cells were infected with MVA/T7pol vaccinia virus [36 (link)] for 1 h at 37°C and subsequently transfected with 4 or 8 μg of plasmid DNA by using Metafectene reagent (Biontex Laboratories GmbH, Munich, Germany). Transfected cells were incubated for either 24 h or 48 h at 37°C for protein expression. Cells were harvested at indicated time points and subsequently lysed for SDS-PAGE and western blot analysis.
+ Open protocol
+ Expand
8

Molecular Characterization of SMN and BAP1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Freshly isolated FAPs were cultured at 37°C in alpha-MEM (Hyclone) supplemented with penicillin (100 U/mL), streptomycin (1 mg/mL), and 20% FBS (Hyclone). HEK293T cell line (ATCC) was grown at 37°C in DMEM (Hyclone) supplemented with antibiotics and 10% FBS. The cell line was tested for mycoplasma contamination. All transfections were performed using polyethyleneimine (PEI; Polysciences) and Metafectene reagent (Biontex) following the manufacturer’s instructions. Full-length and point-mutated constructs of SMN were subcloned into the pcDNA4-HisMax vector. N-terminal flag-tagged full-length, deleted, and point-mutated construct of mouse Bap1 and human BAP1 were subcloned into the pcDNA4 or pcDNA3.1 vector (Addgene). HA-tagged Ub was subcloned into pcDNA3 vector.
+ Open protocol
+ Expand
9

siRNA Knockdown of Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following siRNA oligonucleotides targeting HRP‐3,28, 29E2F1, and Cyclin E were synthesized by Integrated DNA Technologies Inc: siHRP‐3, 5′‐GGCCAUGUGUAAAGUUUAAUU‐3′; siE2F1, 5′‐GUCACGCUAUGAGACCUCACUG‐3′; and siCyclin E, 5′‐AAGUGCUACUGCCGCAGUAUCC‐3′. The siRNA duplexes were transfected into cells using Metafectene reagent (Biontex) according to the manufacturer's guidelines.
+ Open protocol
+ Expand
10

PCOLCE2 Knockdown in Transfected TMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
TMSCs were transfected with siRNA for PCOLCE2 (50 nM, Invitrogen, Carlsbad, CA, USA) using Metafectene reagents (Biontex Laboratories GmbH, Munich, Germany). After 72 h, cells were utilised for further study. The sequences of predesigned Stealth Select siRNA (Thermo Fisher Scientific, Waltham, MA, USA) against PCOLCE2 are as follows: sense, 5′-UGGUGAUAGUCCACCUGCGCCAAUU-3′; antisense, 5′-AAUUGGCGCAGGUGGACUAUCACCA-3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!